TABLE 1.

RT-PCR protocols for rapid diagnosis of CoV associated with SARSa

Characteristic or component of protocolWHO-HKUWHO-Hamburg
RTPCRRT-PCRSecond PCR
Primer sequences
    SenseTACACACCTCAGCGTTGATGAATTACCAAGTCAATGGTTACGAAGCTATTCGTCACGTTCG
    AntisenseCACGAACGTGACGAATCATAACCAGTCGGTACAGCTACCTGTAGAAAATCCTAGCTGGAG
Reagent formulationSuperscript II RTA (Invitrogen)AmpliTaq Gold (Roche)Superscript II RT-PCR (Invitrogen)AmpliTaq Gold (Roche)
    (i) 4 μl of 5× first-strand buffer    (i) 5 μl of 10× reaction buffer    (i) 10 μl of 2× reaction buffer    (i) 5 μl of 10× reaction buffer
    (ii) 10 mM DTT    (ii) 200 μM dNTP    (ii) 2.45 mM MgSO4    (ii) 200 μM dNTP
    (iii) 500 μM dNTP    (iii) 2.5 mM MgSO4    (iii) 500 nM (each) primer    (iii) 2.5 mM MgSO4
    (iv) 0.15 μg of random primer    (iv) 250 nM (each) primer    (iv) 0.4 μl of RTA-Taq mixture    (iv) 200 nM (each) primer
    (v) 200 U of Superscript II    (v) 2 U of AmpliTaq Gold    (v) 2 μl of RNA extract    (v) 2 U of AmpliTaq Gold
    (vi) 12 μl of RNA extract    (vi) 2 μl of RT product    (vi) Make up to total volume of 20 μl    (vi) 1 μl of RT-PCR product
    (vii) Make up to total volume of 20 μl    (vii) Make up to total volume of 50 μl    (vii) Make up to total volume of 50 μl
Thermal cycling profile(i) 25°C, 10 min(i) 94°C, 10 min(i) 45°C, 30 min(i) 95°C, 5 min
(ii) 42°C, 50 min(ii) 40 cycles(ii) 95°C, 3 min(ii) 10 cycles
(iii) 94°C, 3 min    (a) 94°C, 30 s(iii) 10 cycles    (a) 95°C, 10 s
    (b) 50°C, 40 s    (a) 95°C, 10 s    (b) 60°C, 10 s (decrease by 1°C/cycle)
    (c) 72°C, 15 s    (b) 60°C, 10 s (decrease by 1°C/cycle)    (c) 72°C, 20 s
(iii) 72°C, 10 min    (c) 72°C, 30 s(iii) 20 cycles
(iv) 40 cycles    (a) 95°C, 10 s
    (a) 95°C, 10 s    (b) 56°C, 10 s
    (b) 56°C, 10 s    (c) 72°C, 20 s
    (c) 72°C, 30 s
Expected PCR product size (bp)182189108
  • a The RT-PCR protocols of two WHO SARS network laboratories, WHO-HKU (8) and WHO-Hamburg (4), are also available online (http://www.who.int/esr/sars/primers/en. Abbreviations: RTA, reverse transcriptase; DTT, dithiothreitol; dNTP, deoxynucleoside triphasphate.