Table 1.

Primers and probes used in the study

Primer or probeSequence (5′–3′)aPositions (bp)b
PPNG-F1AATTCATTTAAAAAATCAGATTTTGAGCCTA671–701
PPNG-R1ACGAAAGTTACCAATGAAGATTTGC774–750
PPNG-TM1FAM-ATCTATTGCTATCGTTACCCGCTAGAAATACCCAG-BHQ708–742
PPNG-F2AGCTGTTCGTTTTTTACTACCAATCA937–962
PPNG-R2TGATTTAGTCGTTGAGGTTGAACAA1024–1000
PPNG-TM2FAM-AATTTAAAGAGTGAATAGTACGCCCACGCTTGA-BHQ966–998
  • a FAM, 6-carboxyfluorescein; BHQ, black hole quencher.

  • b Asian plasmid (GenBank accession number U20374).