TABLE 2.

Variation in normalized pixel intensities for similar oligonucleotidesa

SegmentSequenceE-valuePixel intensity
1AATCTAATGTCGCAGTCTC−4.00
1CTGATGTCGCAGTCTCGCAC−2.77,283
1CTGTCAGTAAGTATGCTAGAGTCCC−7.243,161
1GGCTGTCAGTAAGTATGCTA−4.57,289
2TTGAATGGATGTCAATCCGA−4.50
2GAATGGATGTCAATCCGACC−4.50
4TTTCTAATATCCACAAAATGAAGGC0.50
4ACCAAAATGAAGGCAAACC−4.07,769
4CAGATGCAGACACAATATGT−4.53,314
4CAGATGCAGACACAATATGTATAGG−7.21,341
4AAACCGGCAATGGCTCCAAA−4.54,842
4ACCGGCAATGGCTCCAAA−3.41,581
4GATGCAGACACAATATGTATAGG−6.20
4CAGATGCAGACACAATATGT−4.53,314
4CAGATGCAGACACAATATGTATAGG−7.21,341
4AAAGCAGGGGAAAATAAAAACAACC−7.252,256
4GCAGGGGAAAATAAAAACAACC−5.552
4GCAGGGGAAAATAAAAGCCAC−2.00
5TGCGGGGAAGGATCCTAAGAAAAC−4.36,709
5GGGAAAGATCCTAAGAAAAC−4.5884
5TCCTCTGCATTGTCTCCG−3.458,051
5CTCTGCATTGTCTCCGAAG−4.048,211
7GTCAGCATCCACAGCACTCTGCTGTTCC−9.010,645
7TCGTCAGCATCCACAGCA−3.456,454
7GACCAGCACTGGAGCTAGGA−4.536,488
7GACCAGCACTGGAGCTAGGG−4.015,976
7GGCAAGTGCACCAGCAGAATAAC−6.233,891
7GGCAAGTGCACCAGCAGAATAACT−6.748,119
7AGCGTAGACGCTTTGTC−3.00
7CTGCAGCGTAGACGCTTTGTCCAAAATG−9.07,788
8CCCATTCTCATTACTGCTTC−4.554,028
8ATAATGTTTTTCTCATTACT0.91,731
KYATTGACCCCTAACCCACG30,727
KYCTGCCTGATTGACCCCTAACC60,471
KYTATCCTGCCTGATTGACC18,603
KYTTATCCTGCCTGATTGACC4,997
KYCTTATCCTGCCTGATTGACC24,744
KYTGCTTATCCTGCCTGATTGACC9,453
  • a Values reported with segment numbers are from hybridization of the influenza virus oligonucleotide microarray with PR8 cDNA target, whereas those identified as “KY” are from hybridization of the microarray with KY98 cDNA target. Values are normalized mean net median pixel intensities for quadruplicate spots. Negative values (due to spot intensities being insignificantly less that background intensities) are reported as zeros.