TABLE 2.

Nucleic acid targets for primers and probes

Purpose and nameProduct size (bases)Sequence (5′-3′)aTargetb
Primers
    DGF24 AGACATGACHTTYGAGGTGGAYCC AdV (24 types)
    DGR19 CGCAGGTASACBGYYTCRA AdV (25 types)
    31F25 AGATATGACATTTGAAGTTGACCCC AdV31
    31R21 CGCAGATAGACCGCTTCAATG AdV31
    4F23 AGACATGAATTTCGAAGTCGACC AdV4
Probes
    98A1223 TACGCATTCACCAGCCACACCGC AdV12
    98A18/31R25 CGCACCACGTCGAAAACTTCAAACA AdV18, AdV31
    98B122 CAGAGTGCACCAGCCACACCGC Group B:1 (types 3, 7, 7a, 16, 21, 50)
    98B223 TCAGAGTGCATCAGCCACACCGC Group B:2 (types 11, 14, 34, 35)
    98C24 TCCGTGTGCACCAGCCGCAC Group C (types 1, 2, 5, 6)
    98D21 TCAGAGTGCACCAGCCGCACC Group D (types 8, 9, 10, 17, 19, 28, 37, 48)
    98E420 TCCGAGTGCACCAGCCCCAC Group E (type 4)
  • a IUB codes: B = C, G, or T; H = A, C, or T; R = A or G; S = G or C; Y = C or T.

  • b Hexon gene of human AdV type and subgenus; types whose nucleotide sequences were used to determine the consensus sequence are listed. See Table 1 for GenBank accession numbers.