TABLE 1.

Characteristics of tandem repeat loci

Locus nameaAssociated open reading frameMotif length (bp)No. of units in PAO1% G+C content% ConservationPrimer sequencebExpected PCR product length in PAO1 (bp)Estimated size range (bp)No. of allelesPolymorphism index
ms010-0098_6bpcPA008161165100L: GCAGGAACGCTTGCAGCAGGT167143-233160.91
R: CTTCGCCGACCCAGGGATCA
ms061-1844_6bpa pscP 6126598L: CTTGCCGTGCTACCGATCC12785-139100.87
R: CCCCCATGCCAGTTGC
ms077-2263_39bpc pcoA 3955793L: GCGTCATGGTCTGCATGTC442349-52070.61
R: TATACCCTCTTCGCCCAGTC
ms127-3496_15bpPA31151587252L: CTCGGAGTCTCTGCCAACTC210210-22520.45
R: GGCAGGACAGGATCTCGAC
ms142-3873_115bpPA346311576694L: AGCAGTGCCAGTTGATGTTG890200-77570.68
R: GTGGGGCGAAGGAGTGAG
ms172-5083_54bpPA454154126472L: GGATTCTCTCGCACGAGGT789573-84380.75
R: TACGTGACCTGACGTTGGTG
ms173-5186_243bpPA4625243146181L: CTGCAGTTCGCGCAAGTC3,5031,073-4,718100.82
R: ATTTCAGCCAGCGTTACCAA
ms194-5915_12bpc algP 12457064L: CCTTAGGAGGCGCTGGTC690600-70080.78
R: AGCTGCTGGCAAGGCTCT
  • a Loci are listed according to their positions in the PAO1 genome. The proposed reference name includes the size of the repeat unit.

  • b L, left; R, right.

  • c The observed length variations do not fit with the repeat unit proposed in the minisatellite database but, rather, suggest a smaller (ms010, ms061, ms194) or a larger (ms077) unit for tandem repeat variation. This is due to the emergence of a new tandem repeat unit within a larger tandem repeat. The new unit sequence is derived from the preexisting repeat but has a different length. This was checked in particular for ms077 by sequencing the different alleles (data not shown; the data are available on request).