TABLE 2.

Oligonucleotide primers for amplification and sequencing of loci used in MLST scheme

LocusGene productGenBank accession no.PrimerPrimer sequence (5′-3′)Annealing temp (°C)
FKS 1,3-Beta-glucan synthase AF229171 FKSF1GTCAAATGCCACAACAACAACCT55.0
FKSR1AGCACTTCAGCAGCGTCTTCAG
LEU2 3-Isopropylmalate dehydrogenase U90626 LEU2F1TTTCTTGTATCCTCCCATTGTTCA54.0
LEU2R1ATAGGTAAAGGTGGGTTGTGTTGC
NMT1 Myristoyl-CoA, protein N-myristoyltransferasea AF073886 NMT1F1GCCGGTGTGGTGTTGCCTGCTC59.0
NMT1R1CGTTACTGCGGTGCTCGGTGTCG
TRP1 Phosphoribosyl-anthranilate isomerase U31471 TRP1F1AATTGTTCCAGCGTTTTTGT50.0
TRP1R1GACCAGTCCAGCTCTTTCAC
UGP1 UTP-glucose-1-phosphate uridylyltransferase AB037186 UGP1F1TTTCAACACCGACAAGGACACAGA57.0
UGP1R1TCGGACTTCACTAGCAGCAAATCA
URA3 Orotidine-5′-phosphate decarboxylase L13661 URA3F1AGCGAATTGTTGAAGTTGGTTGA53.0
URA3R1AATTCGGTTGTAAGATGATGTTGC
  • a CoA, coenzyme A.