Table 1.

Primer sequences for the H-antigen PCR assay

Primer nameConcn (╬╝mol)Sequence
1EN_F11CGCTGAACGTGCAGAAAGAGTATGATGT
1EN_F21AACGTGCAGAAAAAATATGATGT
ri_F1GTGCAACAAAAATATAAGGTCAGC
bd_F1GCGAACGACGGTGAAACTAT
G_F1TCCAGCTTCAAGAATGTTACGGG
z51_F1ATCTAATTTCAAAAACGTTACTGG
z29_F1AAAAAGCCTTGGAATGGATGG
Z4_F1AGCTGGGCTTAGATAAATTAGATGT
L_F1GCAGAAAAAATATGATGTGAAGAGC
1ENL_R5AACTGCCTTCAATTGTCTTACC
ri_R5CACCCGCTGCTGTCAATG
b_R5CGGTCACCTCAACGAAGTAG
G_R5TATAAACATTTTTGCTTGATTGTAAGG
mt_R5TAGCAGTATATTCAGCTCCCATT
c_R5ATTTATTCGTCAGCAGTTTTTTC
y_R5AACCGCCTTCAATTGTTTTACC
eh_R5CGTCAATAGATTTTCCATTTTTATC
z29_R5CCGCGTTAACAAATGACAGC
Z4_R5GGCAGATTCAAAACGGTTC
d_R5GCATAGCCACCATCAATAACC