TABLE 2.

Oligonucleotide primers used for C. albicans MLST

LocusPrimerSequence (5′→3′)Amplicon size (bp)
CaACC1466 forwardGCAAGAGAAATTTTAATTCAATG
466 reverseTTCATCAACATCATCCAAGTG519
CaVPS13552 forwardTCGTTGAGAGATATTCGACTT741
552 reverseACGGATGGATCTCCAGTCC
CaGLN4598 forwardGAGATAGTCAAGAATAAAAAAGT483
598 reverseATCTCTTTCATCTTTTGGACC
CaADP1904 forwardGAGCCAAGTATGAATGATTTG537
904 reverseTTGATCAACAAACCCGATAAT
CaRPN21041 forwardTTCATGCATGCTGGTACTAC447
1041 reverseTAATCCCATACCCAAAGCAG
CaSYA11369 forwardAGAAGAATTGTTGCTGTTACTG543
1369 reverseGTTACCTTTACCACCAGCTTT