Table 2.

Probe sequences

H antigenSequence
a-1aCCTTCGGCTACATTAAGCACT
a-2aTCTACAACTGATACTGGTTC
bTGCCTATACGCCAAAAGGTACC
cCTGGCGCAGCTAGCTTGAAAG
dACTACAAAGAAAGTTAATATTGATAC
jACTGGCGCCGATAAGGAC
e,hGGCGATTCCTTGTCTGCTACG
iTTGATAAGACGAACGGTGAGGT
kATGGTTTCCTTAAAGTTGACGTTAATAC
rGGCACACCAACAGGACCAAT
z10AACCAACGAATGCAGTTGAA
zCAATTGGGGCCTCGACTACTA
z35TGCTAAGAGCGGTTACTATAA
z29TGGCGCGCACAAAGCAAC
z6TTACAGACCCAGAAATTGCTG
yAAGCACTACGATGCCTACTGC
L-compAAAAGGCCAATTAGTTACGAT
vcAATGCCGACAACCACtGAAAG
z28AACCGCCGCGAAAGTGACA
EN-comp-1aCACTGTAAGTGGTTATAC
EN-comp-2aCACTGTAGGTGGTTATACCGATGC
xcATATTATTCCACTGTAAGTGtGTTATACC
z15cCTGTAGGTGtGTTATACCGATGC
1-compCAATAATGGTACTACACTGGATGTAT
2b,cGTGtGTACGAATGGTACtGGC
5-1aGTGGTACGACTGGTACGGC
6GTACGCTTGGCACGGCTTCTGTAA
7CGAATGGTGCACCTAGTGTAACAGGTA
G-compAAGCGACAGTGGGTGATCTGA
fcCGGtCGAATGTTGATGtCTGCTAC
m/g,mTATTGCCACTGGCGCGAC
m/m,tGTTTATACTTCCGTTGTAAGCGGTC
pTGATATTGCCATTGGCGCTGGCG
sCTGCGGTTAACCTATTCAtAGACGACTA
t-1GCTCCAACTGTTCCTGATAAAGTATACGTA
z51TATTAATTCTGGAGCAGTAACTGATGA
Z4-compACCGAGCTGGGCTTAGATAAAT
z24GCTACCGTAGATAATAGTACTGGG
  • a Antigens that required more than probe to capture all or most alleles.

  • b The probe contains locked nucleic acid nucleotides (shown in bold).

  • c The probe contains an additional thymine nucleotide(s) indicated as a lowercase t, required for improvement of specificity.