Table 3.

Oligonucleotide primers and molecular beacon probes used in this studya

Primer/probebSequence (5′ to 3′)cSize (bp)5′ fluorescent dye3′ quencher
KPC-F107TCGAACAGGACTTTGGCGGCT260
KPC-R366GGACAGCTCCGCCACCGTCATG
MB147Ggcgct CGATGGATACCGGCTCA agcgcFAMDABCYL
MB308Ccgcga CTGGTTCCGTGGTCAC tcgcgHEXDABCYL
MB308Tcgcga CTGGTTCTGTGGTC tcgcgQuasar 670dBHQ-2
KPC-F684GGCAGTCGGAGACAAAACC177
KPC-R860CCCTCGAGCGCGAGTCTA
MB716Tcgcga AACCTGCGGAGTGTATGG tcgcgAtto 425DABCYL
MB716Ccgcga AACCTGCGGAGCGTATGG tcgcgQuasar 670dBHQ-2
MB814Ccgacg GACAAGCACAGCGAGG cgtcgCAL Fluor Red 610BHQ-2
  • a FAM, fluorescein; HEX, hexachlorofluorescein; DABCYL, 4-(4′-dimethylaminophenylazo)benzoic acid; BHQ, black hole quencher.

  • b Oligonucleotide primer sets spanning nucleotide positions 107 to 366 and 684 to 860 were used to amplify two segments, each containing two molecular beacon target positions. Positions 308 and 716 are targeted by more than one molecular beacon probe.

  • c Molecular beacon hairpin sequences are shown in lowercase letters. Single nucleotide polymorphism target positions are underlined, as in Table 2.

  • d Quasar 670 dye is used for both MB308T and MB716C, as explained in Table 2.