TABLE 1.

Gene targets for HSV, CMV, VZV, and EHV-4 primer sequences used and their target product sizes

VirusTarget geneProduct sizea (bp)Primer sequenceb
HSVcGlycoprotein BR1 5′GCACACCACCGACCTCAAGTACAA
370R1 3′CCTGCCACTTGGTCATGGTG
R2 5′ GCATGCTCGAGGAGGTTGGAC
149R2 3′ TTGAAGCGGTCGGCGGCGTA
HSV-2US-4R1 5′ACGTACTACCGCCTCAC
258R1 3′CCACCTCTACCCACAAC
R2 5′CCGCGCCTGCCGTCAGCCCATCCTC
225R2 3′ AGACCCACGTGCAGCTCGCCG
CMVUL123R1 5′ CAAGCGGCCTCTGATAACCAAGC
438R1 3′ CTCTTCCTCTGGGGCAACTTCCTC
R2 5′ CCGATCCTCTGAGAGTCTGCTCTC
190R2 3′ CAGCCACAATTACTGAGGACAGA
VZVMatrixR1 5′ ATGTCCGTACAACATCAACT
450R1 3′ GGAGACTGGATATGCACGCATC
R2 5′ CGATTTTCCAAGAGAGACGC
99R2 3′ GGTGGAGACGACTTCAATAGC
EHV-4Glycoprotein BR1 5′ CTGCTGTCATTATGCAGGGA
509R1 3′ CGTCTTCTCGAAGACGGGTA
R2 5′ CTGCTGTCATTATGCAGGGA
323R3 3′ CGCTAGTGTCATCATCGTCG
  • a Upper value represents first-round product size; lower value represents second-round product size.\

  • b R1 = first-round primers; R2 = second-round primers.\

  • c Primers for HSV are specific for both HSV-1 and HSV-2 DNA.