TABLE 4.

Polymorphic nucleotide sites in the atpA locusa

atpA alleleNo. of strainsNucleotide at polymorphic site:
59629598107122128176188230239242248254266269284314320323329335347479482485527539542551
519TGCTCACGTGGCCGCACTGCGCTAAAACTA
161..............A...............
152...................T..........
101...........................T..
912.........................G....
132..........A..............G....
815........C............T...G....
171....T...C............T...G....
61........C..TT.....A.A....G....
111.AT.....C.............C..G.T..
417A..ATG.A...............GGGG..C
73A..ATG.ACTA.TATCT......GGGG..C
39A..ATG.ACTA.TA.CT......GGGG..C
121A..ATG.ACTA.TA.CTC.....GGGG..C
213A..ATG.ACTA.TA.CTC.....GGGG.GC
141A.TATGTACTA.TA.CTC.....GGGG..C
124A.TATGTACTA.TA.CTC.....GGGG.GC
  • a Nucleotides present in the variable sites are shown for the first allele. In the other alleles, only the sites that differ are shown. A period means that the site is the same as that in the first allele.