TABLE 2.

List of primers used in this study

Protein encoded by genePrimerNucleotide sequence (5′-3′)
16S rRNAfD1aAGAGTTGATCCTGGCTCAG
Rp2aACGGCTACCTTGTTAGGACTT
357fTACGGGAGGCAGCAG
357raCTGCTGCCTCCCGTA
536FCAGCAGCCGCGGTAATAC
536RGTATTACCGCGGCTGCTG
800FATTAGATACCCTGGTAG
800RCTACCAGGGTATCTAAT
1050FTGTCGTCAGCTCGTG
1050RCACGAGCTGACGACA
35 kDa35KD1faGTCGCTAAAGGCTGATGA
35KD2raGACTGATATCGTGCGTGTG
35KDs1fGGTACGACGACAGTAATTGTT
35KDs2rGATTTAAGAGATACCAACCA
Pap 31PAP1faCTTTAATGACGACTTCTGTT
PAP4raCCGAAATCTGAGTAACGGTA
PAP2rCCCTAAATGTTTCAAGTTCA
PAP3fGCTGACAGAGAAGACGCAA
ITS16SFaAGAGGCAGGCAACCACGGTA
23S1aGCCAAGGCATCCACC
QHVE1TTGGGATCATCATCTGAA
QHVE2TTGGGATCATCATCTGAA
QHVE3GATATATTCAGACATGTT
QHVE4AACATGTCTGAATATATC
  • a Primer used for PCR amplification and sequencing.