TABLE 3.

Polymorphic nucleotide sites in the gdh locusa

gdh alleleNo. of strainsNucleotide at polymorphic site:
34245606972105108129135147150156189195207219222237246255264270285297303312360369374375396424432444447450468474481492510
189GGCTTTCGGTGCCTACCTATACTGCAATTCTTTGGAACGAAC
21.........................................T
31......................A...................
67.....................................T....
111.............................T.......T....
511...........................A..............
123.................C........................
74.................C......................T.
41AA.ACCTAACATACCA.CTCG..TTGG.C.GCCATGG.AC..
83A..ACCTAACATACCA.CTCGA.TTGG.C.GCCAT.G.AC..
91A.TAC.TAACATACCA.CTCG..TT.G.C.GCCAT.G.AC..
101A..ACCTAACATACCATCTCGA.TTGG.C.GCCAT.G.AC..
  • a Nucleotides present in the variable sites are shown for the first allele. In the other alleles, only the sites that differ are shown. A period means that the site is the same as that in the first allele.