TABLE 3.

PCR primers

Primer namePrimer target and directionSequence (5′→3′)
LmsigB-15sigB, forwardAATATATTAATGAAAAGCAGGTGGAG
LmsigB-16sigB, reverseATAAATTATTTGATTCAACTGCCTT
Prs-Fprs, forwardGCGCGAAACAAGACAACAAAC
LMVI-prfAprs, reverseGC(T/A)GTTAG(C/T)AGAATT(C/A)TTTC
ActA-F176actA, forwardTAGCGTATCACGAGGAGG
ActA-R2148actA, reverseTTTTGAATTTCATATCATTCACC
ActA-CFactA, forward, lineage IIITTTATGCGTGCGATGATGGTAGTT
ActA-DRactA, reverse, lineage IIICTTTTTCGTCTTCTGCACTTTTAG
2plcB-ecoRactA, reverse, FSL W1-110 and FSL X1-002GGAATTCTTTATGTGGTAATTTGCTGTC
recA-F23recA, forwardGTTCGCTTTTTGCTTGCTTCTC
recA-R1368recA, reverseAAAAACTTCCCCCTTGTCTCC
inlAF1inlA, forwardCAGGCAGCTACAATTACACA
inlAR1inlA, reverseATATAGTCCGAAAACCACATCT
hlympl-Fhly-mpl, forwardTCTCCATCTGGGGCACTACAC
hlympl-Rhly-mpl, reverseTTACCATGATGATACAAATA
plcAhly-FplcA-hly forwardCCGCCTAATGGGAAAGTAAA
plcAhly-RplcA-hly reverseAGGCGGAGATGCTGGTG