Table 1.

RT-LAMP primer sets designed for rapid detection of EV71

PrimerGenome positionaLength (bp)Sequenceb (5′–3′)
F31921–193818CTTCCCGGTCTCAGCACA
B32104–212320GCGGTGTATAGGCTATGAGC
FIP(1999–2019) + (1939–1956)43TGACCCAGCAAGGTGGATTGCTTTTAGCAGGGAAAGGTGAGCT
BIP(2024–2044) + (2074–2092)44TGCGGGTACTACACCCAATGGTTTTAGCCATGAAGGACCCAGTA
LF1957–197620CGGCTCTGAACACCGCACAC
LB2048–207225GGATCATTGGAAGTCACCTTCATGT
  • a EV71 strain Henan10-08 (GenBank accession no. GU366191). FIP and BIP are long primers containing two recognition sequences (positions indicated with parentheses) with a TTTT linker.

  • b Underlined portions indicate a TTTT linker.