TABLE 1.

Primers and conditions used for RT-PCR assays for the detection and characterization of HAV

Target regionSequenceLocationa[Mg2+] (mM)Primer annealing temp (°C)
5′ NCRTCACCGCCGTTTGCCTAG68-851.555
5′ NCRGGAGAGCCCTGGAAGAAAGA241-2221.555
NH2-VP0CAGCTGGACTGTTCTTTGGG648-6672.055
NH2-VP0TCACCAGGAACCATAGCACAG1198-11782.055
COOH-VP0TACAATGAGCAGTTTGCTGT1065-10842.055
COOH-VP0GCTCTTGCATCTTCATAATTTG1543-15222.055
NH2-VP3GGGACAGGAACTTCAGCTTATAC1380-14022.050
NH2-VP3TCTACCTGAATGATATTTGG1859-18402.050
Inner VP3GTTATTCCAGTGGACCCATATT1701-17222.050
Inner VP3TCGTGTACCTATTCACTCTATA2031-20102.050
COOH-VP3TGTGCAGTGATGGATATTACAG1938-19592.050
COOH-VP3GTTGTTATGCCAACTTGGGGA2287-22672.050
NH2-VP1AATGTTTATCTTTCAGCAAT2136-21552.053
NH2-VP1ACAGCTCCAAGAGCAGTTTT2751-27702.053
COOH-VP1ATGGCCTGGTTTACTCCAG2673-26912.545
COOH-VP1CCCTTCATTTTCCTAGG3229-32132.545
  • a Positions are those in strain HM-175 (GenBank accession number M14707 ) (10).