TABLE 2.

PCR primers and conditions for amplification of intimin alleles

PrimercSequence of primer (5′ → 3′)Target sequenceReference strain(s)PCR programSize of product (bp)Reference
SK1CCCGAATTCGGCACAAGCATAAGCConserved re- gion of eae94°C, 30 s; 52°C, 60 s; 72°C, 60 sa,b86332
SK2CCCGGATCCGTCTCGCCAGTATTCGEDL933, E2348/69
LP2CCCGAATTCTTATTTTACACAAGTGGCeaeE2348/6994°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b2,80733
LP3CCCGAATTCTTATTCTACACAAACCGCeaeEDL93394°C, 30 s; 48°C, 60 s; 72°C, 90 sa,b2,79233
94°C, 30 s; 55°C, 60 s; 72°C, 90 sb,e
LP4CCCGTGATACCAGTACCAATTACGGTCeaeRDEC-194°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b2,28728
LP5AGCTCACTCGTAGATGACGGCAAGCGeaePMK594°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b2,60828
LP6BTAGTTGTACTCCCCTTATCCeae4795/9594°C, 30 s; 53°C, 60 s; 72°C, 150 sa,b2,430This study
LP7TTTATCCTGCTCCGTTTGCTeae7476/9794°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b2,685This study
LP8TAGATGACGGTAAGCGACeaeCF1120194°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b2,590This study
LP10GGCATTGTTATCTGTTGTCTeae6044/9594°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b2,769This study
LP11BGTTGATAACTCCTGATATTTTAeaeCL-3794°C, 30 s; 50°C, 60 s; 72°C, 150 sa2,686This study
94°C, 30 s; 50°C, 60 s; 72°C, 150 sb
  • a Before the first cycle the sample was denatured for 2 min at 94°C.

  • b After the last cycle, the sample was extended for 5 min at 72°C.

  • c Primer SK1 was used as forward primer in all PCR approaches in combination with SK2, LP2, LP3, LP4, LP5, LP6B, LP7, LP8, LP10, and LP11B.

  • d Three cycles

  • e Twenty-eight cycles.