TABLE 1.

Primer sequences used in the multiplex PCR assay and the expected sizes of the products

PrimerSize (in bp)Sequence (5′-3′)GenBank accession no.Target geneGene location (bp)
CJF323ACTTCTTTATTGCTTGCTGCZ36940C. jejuni hipO1662-1681
CJRGCCACAACAAGTAAAGAAGC1984-1965
CCF126GTAAAACCAAAGCTTATCGTGAF136494C. coli glyA337-357
CCRTCCAGCAATGTGTGCAATG462-444
CLF251TAGAGAGATAGCAAAAGAGAAF136495C. lari glyA318-337
CLRTACACATAATAATCCCACCC568-549
CUF204AATTGAAACTCTTGCTATCCAF136496C. upsaliensis glyA63-82
CURTCATACATTTTACCCGAGCT266-247
CFF435GCAAATATAAATGTAAGCGGAGAGAF048699C. fetus sapB22509-2532
CFRTGCAGCGGCCCCACCTAT2943-2926
23SF650TATACCGGTAAGGAGTGCTGGAGZ29326C. jejuni 23S rRNA3807-3829
23SRATCAATTAACCTTCGAGCACCG4456-4435