TABLE 1.

stx genes expected to be detected by PCR or PCR-RFLP methods used in this study

Primer pairs for indicated stx genesaSize (bp) of PCR productstx geneSizes (bp)b of restricted PCR-RFLP productsReference(s)
All (HincII and AccI)
    LIN (5′ GAACGAAATAATTTATATGT) and LIN (3′ TTTGATTGTTACAGTCAT)ca. 900 stx 1 705, 158, 32; 768, 1271, 27
stx 1vO111 705, 158, 32; 768, 127
stx 2 555, 262, 62; 544, 351
stx 2c 555, 324, 16; 544, 351
stx 2vha 555, 324, 16; 544, 351
stx 2vOX393 555, 324, 16; 544, 351
stx 2vbb 555, 340; 544, 351
stx 2vO111 880, 15; 544, 351
stx 2vOX392 880, 15; 544, 351
stx 2e 555, 340; 900
stx 2ev 521, 374; 900
stx 2d
    VT2-cm (AAGAAGATATTTGTAGCGG) and VT2-f (TAAACTGCACTTCAGCAAAT)256 stx 2d-Ount c37
stx 2d-OX3a c
stx 2d (HaeIII and PvuII)
    VT2-e (AATACATTATGGGAAAGTAATA) and VT2-f (TAAACTGCACTTCAGCAAAT)348 stx 2d-Ount 216, 132; 200, 120 (28)d37
stx 2d-OX3a 167, 132 (49)d; 200, 120 (28)d
  • a Restriction enzymes are given in parentheses after gene designations.

  • b Sizes are grouped according to the order in which the restriction enzymes are given in column 1.

  • c —, detection of stx2d-Ount (256 bp) and stx2d-OX3a (256 bp) by PCR with no restriction enzymes.

  • d This fragment did not resolve or was too small to be clearly visible under the electrophoretic conditions used.