TABLE 1.

Primers and hybridization temperatures used in the amplification reactions for the virulence factors

Virulence factorOligonucleotide sequence (5′-3′)Annealing temp (°C)Size (bp) of amplified productReference
papCGACGGCTGTACTGCAGGGTGTGGCG6332827
ATATCCTTTCTGCAGGGATGCAATA
cnf1AAGATGGAGTTTCCTATGCAGGAG6349827
CATTCAGAGTCCTGCCCTCATTATT
aerTACCGGATTGTCATATGCAGACCGT6360227
AATATCTTCCTCCAGTCCGGAGAAG
hlyAACAAGGATAAGCACTGTTCTGGCT631,17727
ACCATATAAGCGGTCATTCCCGTCA
satACTGGCGGACTCATGCTGT5538720
AACCCTGTAAGAAGACTGAGC
fimAGTTGTTCTGTCGGCTCTGTC55447This study
ATGGTGTTGGTTCCGTTATTC
papGIIICATTTATCGTCCTCAACTTAG55482This study
AAGAAGGGATTTTGTAGCGTC
aafIITGCGATTGCTACTTTATTAT5524226
ATTGACCGTGATTGGCTTCC
bfpACAAAGATACAACAAACAAAAA5526023
TTCAGCAGGAGTAAAAGCAGTC