TABLE 1

LAMP oligonucleotide primer sequences specific to Candida auris

PrimerSequence (5′→3′)
AurisFIPAGGCTACTGAGCTTGCTGGTGTAACCAAACCAACAGGAGAGG
AurisBIPACGGTTTCAGGGTTAGCATGGCTCAACAAAGTCGCTGGTACA
AurisLoop-FCATCTCGAAGGCCTCGGT
AurisLoop-BCACATACTCGAACGGAGTC
AurisF3GGGAAAGGAACCCTGACCT
AurisB3GGACACAGCATTCGAAGTGT