TABLE 2

PCR primers and conditionsa

PCRSpeciesPrimerSequenceProduct size (bp)Mg2+ concn (mM)Annealing temp (°C)
Outer PCRF. tularensisISFtu_OFTTAAATCTGGAGAGTACGGAGGTAGA1502.565
ISFtu_ORCACTTATGCCCATCATTAAAACCT
B. anthracisPag-OFGGGAAAGAACTTGGGCTGAA122
Pag-ORCGAAGTCGTTGGTAACACGTTG
Y. pestisPla-OFCGGGGAGGATGTCTGTGGAA122
Pla-ORCGTGGAGAATGTCAAGGCAAAA
B. globigiiIC_FAGCGCTTGCGGCAAACACGGAGAAA246
IC_RGCGACACCGGCGAATACAGAGATACC
Inner PCRF. tularensisISFtu_IFTGGCTATTTCAATCAGCTTAGAGG80660
ISFtu_IRCCCATCATTAAAACCTAAAACTAC
B. anthracisPag-IFCCGCTGATACAGCAAGATTAAATGC81
Pag-IRTCGTTGGTAACACGTTGTAGA
Y. pestisPla-IFAGGAGGTTGGTGTTTGACCA74
Pla-IRAATGAGCGCCCCGTCATTAT
B. globigiiIC_IFAGCGCTTGCGGCAAACACGGAGAAA159
IC_IRGCTCCACCGAACAATCCGATCTTACCGCCC
ProbesF. tularensisISFtu-bcnFAM-ccgcgGAAACTAGCATTATCCATTACTATAGTAGcgcgg-CDQ38
B. anthracisPag-bcnCF3-ccgcgGATATGTAAATACTGGGACGGCTCCcgcgg-CDQ38
Y. pestisPla-bcnCF5-ccgcgACCTTCAGATGTGTGAAAAATCACCTcgcgg-CDQ38
B. globigiiIC-bcnCF11-cggccGACAGACAAGC(T42)CCGTCATTTGA(U01)cggcc-DABCYL
  • a Pag, Bacillus anthracis protective antigen; OF, outer PCR forward primer; OR, outer PCR reverse primer; IF, inner nested PCR forward primer; IR, inner nested PCR reverse primer; bcn, molecular beacon. Pla, plasminogen activator; ISFtu, insertion sequence of Francisella tularensis; CF3, CF5, CF11, and FAM, fluorophores; CDQ38 and DABCYL, quenchers; T42 and U01, nucleotide modifications. Lowercase letters in the probe sequences indicate the nontarget sequence used in the molecular probe.