Table 1.

Oligonucleotide sequences of the primers and probes used in real-time RT-PCR assays

AssayTarget geneLocationSequencefAmplicon size (bp)
SW-NS-60NSd60 → 169aFwd primer: GCGATTTGCAGACAATGGATTG110
Probe: AAAGTCCTTAAAAGGAAGAGGCAACACC
Rev primer: CTGTTTCGATATCGAGGCCA
SW-NS-183NS183 → 300aFwd primer: GAAACAAATCGTGGAATGGATCT118
Probe: CAATTGCATCTGTACCTACTTCGCGC
Rev primer: TCGTGACATTTCCTCGAGG
SW-NS-631NS631 → 719aFwd primer: AGACCTTCACTACCTCCAGAG89
Probe: TGAAAAGTGGCGAGAGCAATTGGGACA
Rev primer: TTTCTTCAATTAACCACCTTATTTCC
SW-H1-674HAe (HA1 region)674 → 798bFwd primer: AGAAGTTCAAGCCGGAAATAGCAATAAG125
Probe: AATGAACTATTACTGGACACTAGTAGAGCCG
Rev primer: CACTAGATTTCCAGTTGCTTCGAATG
SW-H1-1076HA (HA2 region)1076 → 1197bFwd primer: CAGGGATGGTAGATGGATGGTAC122
Probe: CAGGATATGCAGCCGACCTGAAGAGCA
Rev primer: AACAGAATTTACTTTGTTAGTAATYTCGTCA
CDC SW H1HA902 → 1017bFwd primer: GTGCTATAAACACCAGCCTYCCA116
Probe: CAGAATATACATCCRGTCACAATTGGARAA
Rev primer: CGGGATATTCCTTAATCCTGTRGC
IA M1MP144 → 238cFwd primer: AAGACCAATCCTGTCACCTCTGA95
Probe: TTTGTGTTCACGCTCACCGTGCC
Rev primer: CAAAGCGTCTACGCTGCAGTCC
  • a GenBank accession number FJ969528.

  • b GenBank accession number FJ966974.

  • c GenBank accession number FJ966975.

  • d NS, nonstructural gene.

  • e HA, hemagglutinin gene.

  • f All oligonucleotide sequences are shown in the 5′-to-3′ orientation. All probes were FAM labeled at the 5′ end and contained a black hole quencher at the 3′ end. Fwd, forward; Rev, reverse.