Table 1.

Sequences and optimal concentrations of primers and probes used in the real-time PCR assays

TargetPrimer or probeSequence (5′ → 3′)Amplicon length (bp)Optimal concn (nM)
IS481a852U18CAAGGCCGAACGCTTCAT66100
894L24GAGTTCTGGTAGGTGTGAGCGTAA100
871U22PbCAGTCGGCCTTGCGTGAGTGGG300
hIS1001cBHIS41U20GGCGACAGCGAGACAGAATC67100
BHIS91L17GCCGCCTTGGCTCACTT100
BHIS62U28PdCGTGCAGATAGGCTTTTAGCTTGAGCGC100
pIS1001e135U17TCGAACGCGTGGAATGG65300
199L20GGCCGTTGGCTTCAAATAGA300
157U21PfAGACCCAGGGCGCACGCTGTC100
ptxS1g402U16CGCCAGCTCGTACTTC55700
442L15GATACGGCCGGCATT700
419U22PiAATACGTCGACACTTATGGCGA300
rnasePhrnasePforwardCCAAGTGTGAGGGCTGAAAAG80400
rnasePreverseTGTTGTGGCTGATGAACTATAAAAGG400
rnasePprobebCCCCAGTCTCTGTCAGCACTCCCTTC100
  • a GenBank accession no. M28220.

  • b Probe 5′ end labeled with 6-carboxyfluorescein (FAM) and 3′ end labeled with Black Hole Quencher 1 (BHQ1).

  • c GenBank accession no. AY786982.

  • d Probe 5′ end labeled with Quasar 670 and 3′ end labeled with Black Hole Quencher 3 (BHQ3).

  • e GenBank accession no. X66858.

  • f Probe 5′ end labeled with hexachlorofluorescein (HEX) and 3′ end labeled with Black Hole Quencher 1.

  • g GenBank accession no. M14378.

  • h GenBank accession no. NM_006413.

  • i Probe 5′ end labeled with 6-carboxyfluorescein (FAM) and Black Hole Quencher 1 is at position 14 T (underlined). Previously (38), the probe was 3′ end labeled with Black Hole Quencher 1.