Table 1

Sequences of oligonucleotides and references for RT-PCR and PCR used for detection of enteric viruses

GenusTargetPrimeraSequence (5′–3′)PCR product size (bp)Sensitivity (no. of copies/test)Reference
AdenovirusVP6Hex1deg(F1)GCC SCA RTG GKC WTA CAT GCA CAT C301NTb2
VP6Hex2deg(R1)CAG CAC SCC ICG RAT GTC AAA
VP6Nehex3deg(F2)GCC CGY GCM ACI GAI ACS TAC TTC171
VP6Nehex4deg(R2)CCY ACR GCC AGI GTR WAI CGM RCY TTG TA
Aichi virusLeader/5′ UTRAiV-F65(F1)CACCGTTACTCCATTCAGCTTCTTC9451.517
Leader/5′ UTRAiV-F69(R1)GTTACTCCATTCAGCTTCTTCGGAAC
Leader/5′ UTRAiV-R1039(F2)CAGGATTGGACATCAGAATCATAGAG
Leader/5′ UTRAiV-R1049(R2)GGATAGAACCAGGATTGGACATCAG
Anellovirus5′ UTRuniNG779-(F1)ACWKMCGAATGGCTGAGTTT47
5′ UTRuniNG780-(F1)RGTGRCGAATGGYWGAGTTT
5′ UTRuniNG781-(R1)CCCKWGCCCGARTTGCCCCT
5′ UTRuniNG782-(R1)AYCTWGCCCGAATTGCCCCT
5′ UTRTTV-NG785-(R2)CCCCTTGACTBCGGTGTGTAA112–1175.1–5.4
5′ UTRTTMDV-NG795-(F2)SGABCGAGCGCAGCGAGGAG885.3–5.4
5′ UTRTTMDV-NG796-(R2)GCCCGARTTGCCCCTAGACC
5′ UTRTTMV-NG792-(F2)TTTATGCYGCYAGACGRAGA70–725.3–5.4
5′ UTRTTMV-NG793-(F2)TTTAYCMYGCCAGACGGAGA
5′ UTRTTMV-NG794-(F2)TTTATGCCGCCAGACGRAGG
5′ UTRTTMV-NG791-(R2)CTCACCTYSGGCWCCCGCCC
Astrovirus3DAstro-panF11(F1)GARTTYGATTGGRCKCGKTAYGANT37
3DAstro-pan-F12(F1)GARTTYGATTGGRCKAGGTAYGA
3DAstro-pan-R1(R1)GGYTTKACCCACATICCRAA
3DAstro-pan-F21(F2)CGKTAYGATGGKACKATICC560
3DAstro-pan-F22(R2)AGGTAYGATGGKACKATICC
BocavirusVP1/2Boca-AK-VP-(F1)CGCCGTGGCTCCTGCTCT10–10038
VP1/2Boca-AK-VP-(R1)TGTTCGCCATCACAAAAGATGTG
VP1/2Boca-AK-VP-(F2)GGCTCCTGCTCTAGGAAATAAAGAG500
VP1/2Boca-AK-VP-(R2)CCTGCTGTTAGGTCGTTGTTGTATGT
Cardiovirus2CCardio-Hel(F1)GYCAAATCATCGCHCAAGCAGT265NT9
2CCardio-Hel(R1)TGATTCTYCTATCAACAGCTGG
2CCardio-Hel(F2)CAATCRGTTTAYTCTCTYCCACC
2CCardio-Hel(R2)TATCAACAGCTGGRTAGTGWGC
Coronavirus3D1a-(F1)GTTGTTTATTCWAATGGTGG203NT57
3D1a-(R1)YCTATARCAATTATCATAMAG
3D2a-(F2)WYTRCGTATTGTTAGTAGTTTRGT275
3D2a-(R2)CGTATACTWARATCTTCAATCTT
3DSARS-(F2)GCTGTAACTTATCACACCGT230
3DSARS-(R2)CGGACATACTTGTCAGCTATCT
Cosavirus5′ UTRDKV-N5U-F1 (F1)CGTGCTTTACACGGTTTTTGANT36
5′ UTRDKV-N5U-R2(R1)GGTACCTTCAGGACATCTTTGG
5′ UTRDKV-N5U-F2(F2)ACGGTTTTTGAACCCCACAC316
5′ UTRDKV-N5U-R3(R2)GTCCTTTCGGACAGGGCTTT
Enterovirus5′ UTREntero-5utr_(F1)CAA GCA CTT CTG TTT CCC CGG440NT39
5′ UTREntero-5utr_(R1)ATT GTC ACC ATA AGC AGCCA
5′ UTREntero-5utr_(F2)AAG CAC TTCTGT TTC C317
5′ UTREntero-5utr_(R2)CAT TCA GGGGCC GGA GGA
Norovirus/Sapovirus3DCalici-P290-F1GATTACTCCAAGTGGGACTCCAC319NT32
3DCalici-P289-R1TGACAATGTAATCATCACCATA331
Parechovirus5′ UTR253(F1)GGGTGGCAGATGGCGTGCCATAA243NT28
5′ UTR583(R1)CCTRCGGGTACCTTCTGGGCATCC
5′ UTR313(F2)YCACACAGCCATCCTCTAGTAAG
5′ UTR556(R2)GTGGGCCTTACAACTAGTGTTTG
VP1Parecho-VP1-2090-(F1)GAYAATGCYATMTAYACWATYTGTGA304
VP1Parecho-VP1-2523-(R1)ACWGTRAARATRTCHACATTSATDG
VP1Parecho-VP1-2159-(F2)TTYTCMACHTGGATGMGGAARAC
VP1Parecho-VP1-2458-(R2)DGGYCCATCATCYTGWGCTGA
Picobirnavirus3DB25-GI-FTGG TGT GGA TGT TTC20110–1005
3DB43-GI-RART GYT GGT CGA ACT T
3DB23-GII-FCGG TAT GGA TGT TTC369
3DB24-GII-RAAG CGA GCC CAT GTA
RotavirusVP7Rota-Beg-9 (F1)GGCTTTAAAAGAGAGAATTTCCGTCTGG1,06210–1,00021
VP7Rota-End-9 (R1), (R2)GGTCACATCATACAATTCTAATCTAAG
VP7RVG9-(R1), (R2)GGTCACATCATACAATTCT
VP7G8-Aat8-(F2)GTCACACCATTTGTAAATTCG885
VP7G1-Abt1-(F2)CAAGTACTCAAATCAATGATGG749
VP7G2-aCT2-(F2)CAATGATATTAACACATTTTCTGTG652
VP7G4-aDT4-(F2)CGTTTCTGGTGAGGAGTTG583
VP7G3-aET3-(F2)CGTTTGAAGAAGTTGCAACAG374
VP7G9-aFT9-(F2)CTAGATGTAACTACAACTAC306
Salivirus3DSAL-(F1)GAAGATGCCATTCGTGGTCTCNT43
3DSAL(R1)AGTCCAGAACACGACCAGGTT
3DSAL-(F2)CTTTCCCAATCTCCTGGCTAC400
3DSAL-(R2)GAAGGACAGAGGGGATAGTGG
Sapovirus3DSR80_(F1)TGG GAT TCT ACA CAA AAC CC300NT65
3DJV33_(R1)GTG TAN ATG CAR TCA TCA CC
  • a F1 and F2, forward primers, first and second rounds, respectively; R1 and R2, reverse primers, first and second rounds, respectively.

  • b NT, not tested.