Table 1

Primers for characterization of isolates of Acinetobacter spp.

TargetPrimerSequence (5′ to 3′)Amplicon size (bp)Reference
blaOXA-134-like/rpoB PCRa
    rpoBAc696FTAYCGYAAAGAYTTGAAAGAAG8588
Ac1598RCGBGCRTGCATYTTGTCRT
    A. lwoffii/g sp. 9 blaOXA-134-likeOXA-134F3ACTCAATCSACYCAAGCCA223This study
OXA-134_307R2GTTTCTTGCCATCCCATTTA
Alternative blaOXA-134-like primer pairsa
    blaOXA-134-likeOXA-134_29F2TGAGTTGCTTGGGCCTGA281/290This study
OXA-134_309RGCGTTTCTTGCCATCCC
    blaOXA-134aOXA-134_74FTCCCATCTCAAAGCATTTC234This study
OXA-134_307R2GTTTCTTGCCATCCCATTTA
blaOXA-58-like, 23-like, 51-like, 40-like, -143/class 1 integrase gene/rpoB multiplex PCR
    rpoBAc696FTAYCGYAAAGAYTTGAAAGAAG8588
Ac1598RCGBGCRTGCATYTTGTCRT
    blaOXA-58-likempOXA-58-likeFAAGTATTGGGGCTTGTGCTG59917
mpOXA-58-likeRCCCCTCTGCGCTCTACATAC
    blaOXA-23-likempOXA-23-likeFGATCGGATTGGAGAACCAGA50117
mpOXA-23-likeRATTTCTGACCGCATTTCCAT
    blaOXA-51-likempOXA-51-likeFTAATGCTTTGATCGGCCTTG35317
mpOXA-51-likeRTGGATTGCACTTCATCTTGG
    blaOXA-40-likempOXA-24-likeFGGTTAGTTGGCCCCCTTAAA24617
mpOXA-24-likeRAGTTGAGCGAAAAGGGGATT
    blaOXA-143OXA-143 303F2GATTTTCAAATGGGACGGT90This study
OXA-143 392R2GGAACTGCTGAAAGTGCC
    Class 1 integrase geneInt1FCAGTGGACATAAGCCTGTTC1607
Int1RCCCGAGGCATAGACTGTA
  • a The OXA-134F3/OXA-134_307R2 primer pair (in bold) specifically detected most clinical isolates (29/30) of A. lwoffii/genomic species 9; those with the blaOXA-134a allele (which are missed) were detected using the OXA-134_74F/OXA-134_307R2 primer pair. The OXA-134_29F2/OXA-134_309R primers amplified blaOXA-134-like in A. lwoffii, genomic species 9 and A. schindleri.