Table 1

Overview of primer and probe sequences of TaqMan real-time PCR assays validated in this article

Assay (size in bp)Sequence of:Reference
Forward primer (5′→3′)Reverse primer (5′→3′)Probea
TTS1-orf2 (115)CGTCTCTATACTGTCGAGCAATCGCGTGCACACCGGTCAGTATCFAM-CCGGAATCTGGATCACCACCACTTTCC-BHQ22
TTS1-orf11 (110)ATCGCCAAATGCCGGGTTTCCAAATGGCCATCGTGATGTTCFAM-TCGGCGAACGCGATTTGATCGTTC-TAMRA29
lpxO (91)TTGTTTCGCCTATGCGTTCTCCCACTCGCGCTTGAGGATFAM-ACGTGCCGAACACGCCGTATATCG-BHQ19
8653 (81)ATCGAATCAGGGCGTTCAAGCATTCGGTGACGACACGACCFAM-CGCCGCAAGACGCCATCGTTCAT-TAMRA27
mprA (199)ACTGCTTCGTTCAAGGCGACCGTTGACGGCCTGAACGTCCGCFAM-CAACTTGACGATCAACTGA-MGB21; this article
YLF/BTFC31; this article
    YLF (54)TGCTCGGCTTCCAGATCAGCGGTCAGTTGCCCGCTATTFAM-TCGGACCGCTTGCA-MGBNFQ
    BTFC (96)GGCAGCGTCGAACTGTTCTAGCGAATCAATTCGTTTCCCTTGTVIC-TTCGGCTGCGAAACA-MGBNFQ
266152 (68)E. P. Price et al., unpublished data
    T (B. pseudomallei)AATAAATCATAAACGTGAGGCCGGAGATGTAATAAATCATAAGACCGACATCACGCACAGCVIC-CGGTCTACACGCATGA-MGB
    C (B. thailandensis)FAM-CGGTCTACACGCACGA-MGB
  • a FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine; BHQ, black hole quencher.