Table 2

Primers used in this study

Target genePrimerPrimer sequenceS. aureus strain(s) used for sequencing
Primers used for cloning of antisense products
    rpmJ (SAS078)SAS078forAAATCTAGA AAGACCATCAGTAAAACCTATTTGC
SAS078revAAAGAATTC CCTTGTCTTTGTTTGTGTTTTGG
    SAR1012SAR1012forAAAGAATTC TGTTTATTATCTGTCGGATGTGA
SAR1012revAAATCTAGA CGATGCGTCAATTCATTAAAAG
    SA0772SA0772forAAATCTAGA GGCAGACGAAAGTAAATTTGAA
SA0772revAAAGAATTC TTACTCGCCTTTGTTACCTTTT
    rpmC (SA2039)SA2039forAAATCTAGA GCTAAGGAAATTAGAGACTTAACCAC
SA2039revAAAGAATTC TTTGTTCAATTTCTCTTTCACGA
    rpsT (SA1414)SA1414forAAATCTAGA AAAAAGCTGAAGCACGCAAC
SA1414revAAAGAATTC CGGTCAGCTTTGTTTGAATG
    hup (SA1305)SA1305forAAATCTAGA ATCAATGCAGTTGCAGAGCA
SA1305revAAAGAATTC TGAATGCTGGAACTTTACTTGC
Primers used for PCR and sequencing of genes
    hld (SAOUHSC_02260)SAOUHSC_02260forTGGTTATTAAGTTGGGATGGCLT282-12
SAOUHSC_02260revTTAAGAAAAATTGGAAAATAAATGC
    graF (SAS030)forSAS030GTTTGTAAACTTATGTCAATAGGLT2321-01, LT1261-11
revSAS030AAAATAATTTCGGCGTGTTTCC
    SAS049forSAS049AAACTAAGTGAAAGTATGTATCCCowan, Reynolds, MSSA 19590-11
revSAS049AGGTTTCACTATGGCAGACG
    rpmF (SAS033)SAS033forTTTTTCGTTTATAATCTAAGGAGGATLT243-12
SAS033revCAATCATTTTAAGCGGGACTT
    rpmD (SA2030)forSAOUHSC_02493CTTTACGTGAACCTTCTGCCLT1270-11
revSAOUHSC_02493TGAAGATGTTGCGAAATTACG
    SA1452SA1452forCCATAAAACTCATATTAATCGCTCCTLT98-12, MSSA A796-12, MSSA 1444-12
SA1452revTTTAGCGAACCTCCTTAGTGGT
    graC (SAS044)forSAOUHSC_01362TTTGAGTTTTGGTATCCGAGGLT181-12, LT183-12, LT1784-05, LT825-96
revSAOUHSC_01362GGTCAATACATAGAACATCCC
    SA2039forSA2039CTTTACCTACATAAACTTTACGMSSA A2065-12, LT637-12
revSA2039GTAAAACGTGAGGAATTGGG
    rpsP (SA1081)forSA1081TCTTTACAAACATTCATACACCLT159-12
revSA1081TAACATGTGATATTCCCAACG