Table 1

Real-time PCR assay panel design

Target organismaTarget geneFragment size (bp)Forward/reverse primer sequences (5′–3′)Probe sequences (5′–3′)bMg2+ concn (mM)Primer concns (forward/reverse, in μM)Cycling parametersLimit of detection (CFU/ml of sonicate fluid)% inclusivityc% cross-reactivityc
Anneal temp (°C)Anneal time (s)No. of cycles
Staphylococcus (22)tufd447CAATGCCACAAACTCG/GCTTCAGCGTAGTCTAACGGCCTGTAGCAACAGTAC-FL,e LC640-CGACCAGTGATTGAGAATACGTCCe, GGCGATGCTCAATACGAAGAAAAAATC-FL,f LC705-AGAATTAATGGAAGCTGTAGATACf31/155836550 SCN IDRL-7,371, 325 S. aureus ATCC 43300100 (201/201)0 (0/153)
StreptococcusrpoBg137CCGGHCGTCACGGWAA/CCATACCAAGRTGAAGYTCCATAGGAACGCCAGTTGATATCATGYTKAAYCC-FL, LC640-CTTGGGGTGCCATCACGKATGAA40.4/4571535110 S. agalactiae, 115 S. pneumoniae100 (15/15)h0 (0/339)
Enterococcus/Granulicatella/AbiotrophiarpoB143CGYGAAGCYGGCGATGAAT/AWGGCATRTCTTCTTCYGGCCAYGAAGGRGATAARATGGCSGG-FL, LC640-GTCAYGGWAATAAAGGGGTYGTWTC40.4/455835200 E. faecalis100 (14/14)i0 (0/340)
Enterobacteriaceae other than ProteusrpoB185TCTGCWATYGAAGAAGGCAACT/ATCAGGGAHGCACCRACGCTTGTTCAGCCGCGACC-FL, LC640-GTTGACTACATGGACGTATCCACCCAGC3.50.4/255835190 E. coli83.3 (20/24)j0 (0/330)
Gram-positive anaerobic cocci16S rRNA162TCGCGTCYSATTAGCTAGT/GCTGCATCAGRGTTYCCCACATTGGRACTGAGAHACGGY-FL, LC640-ARACTCCTACGGGAGGCAGCAG2.50.4/25783510 F. magna100 (12/12)0 (0/342)
Propionibacterium/Actinomyces16S rRNA243CGGATTTATTGGGCGTAAAGR/AGGGTATCTAAGCCTGTTCGGGCGAAGGCGGTTCTCTG-FL, LC640-CCTTTCCTGACGCTGAGRAGCG2.50.4/255835200 P. acnes100 (52/52)k0.3 (1/302)l
P. aeruginosa (21)gyrBm222CCTGACCATCCGTCGCCACAAC/CGCAGCAGGATGCCGACGCCGGCGAGACCGATGGCT-FL, LC640-GGCACCGAAGTTCACTTCAAGCCG2.50.4/155835200100 (10/10)0 (0/344)
Corynebacteriumn (20)Kinasen,o143 (forward/reverse 1), 149 (forward/reverse2)CGRTTGTACCARGARCGGT/GCACCTSAAYCCSCGT (reverse 1), CAACGAGCACCTSAACCC (reverse 2)TAGCGCTGGAAGTACCASGAGGT-FL, LC640-GACTCRCGCGGCGACGG, LC705-GACTCGCGCTCGGAAGG40.4/2571035200 C. tuberculo-stearicum, 440 C. jeikeium80 (4/5)p0 (0/349)
ProteusrpoB183CTGTCWGCAATTGAAGAAGGTAACT/GGATCAGTGAWGCACCGACTTGCCGTCATARAGGYG-FL, LC705-TCAAGYTTATTTAGTCGTGAT2.50.4/25583552 P. vulgaris100 (4/4)0 (0/350)
B. fragilis groupleuBq185CGTCCTGAGATAGAACG/GCAGCATTATCCACAAACATATAACTTGCTTCCAGTCGTCTATGGA-FL, LC640-CAGATTGCACAAGAAATGGCGCCGC2.50.4/255835150 B. fragilis92.3 (12/13)r0 (0/341)
  • a References are given in parentheses.

  • b FL, fluorescein; LC640, LightCycler Red 640; LC705, LightCycler Red 705.

  • c Calculated based on 354 isolates.

  • d tuf, elongation factor Tu.

  • e PanStaphHP1 and HP2, probes that detect Staphylococcus aureus and SCN.

  • f SAtufHP1 and HP2, S. aureus-specific probes.

  • g rpoB encodes the β-subunit of RNA polymerase.

  • h S. agalactiae positive, with a Tm of 63°C, compared to Tms of <60°C for other Streptococcus spp.

  • i The G. adiacens (n = 3) and Abiotrophia species isolates had Tms of 58°C and 50°C, respectively, compared to 55°C for the Enterococcus sp. isolate.

  • j The four negative isolates were Morganella morganii, Pantoea agglomerans, Providencia rettgeri, and Serratia liquefaciens.

  • k The Actinomyces spp. had Tms of ≤56°C, compared to 61 to 63°C for Propionibacterium spp.

  • l Corynebacterium amycolatum positive, with a Tm of 58°C.

  • m gyrB encodes DNA gyrase B.

  • n This assay uses one forward and two reverse primers and three probes in the same reaction, primer reverse 1 and probe LC705-GACTCGCGCTCGGAAGG, specific for the resistant species (C. jeikeium and C. urealyticum).

  • o Polyphosphate kinase gene, corresponding to pvdS2 of C. jeikeium K411 (NC_007164).

  • p Corynebacterium group F1 negative.

  • q leuB encodes β-isopropylmalate dehydrogenase.

  • r B. caccae negative.