TABLE 1

RT-LAMP primer sequences used for detection of New Bunyavirus

PrimerSequence (5′–3′)Length (bp)
F3GCAAGATGCCTTCACCAAGA20
B3TGCTGCTTACAGGTTTCTGT20
FIPAGCATGGAGAGGGTCCCTGAAGTCAATGTGAAGATGCGTGGA42
BIPTGTTCGGGTGAAGTGGCTGAAGCAACCTCAGCAGCTCTG39
FLPAGTTATAAACTTCTGTCTTGCTGGC25
BLPCTTGGCCCAGATGGGGTTCC20