TABLE 1

PCR primers used in the multiplex reaction

Target geneSequence (5′ to 3′) of paired primersProduct size (bp)Reference
DT1CGTTGGCTGGCCATTCACGAAGGAGT296Shin et al. (37)
GCTAGTTGGATCGCGCCGAACACCGG
IS900TGGACAATGACGGTTACGGAGGTGG398Shin et al. (37)
CGCAGAGGCTGCAAGTCGTGG
IS311GCGTGAGGCTCTGTGGTGAA608Shin et al. (37)
ATGACGACCGCTTGGGAGAC
IS901CGACGACAGGAGTAGCGGTATGGC754This study
CCGTGCTGCGAGTTGCTTGATGAG