TABLE 1

Primers used to amplify KVAR_0717 (yggE)a

Amplification targetAmplicon size (bp)Primer directionPrimer sequence
Klebsiella spp.330ForwardAGAATGCTTTTCCCGTTCTGA
ForwardAGAATGCTTTTGCCGTTCTGA
ForwardAGAATGCTTTTACCGTTCTGA
ForwardAGGATGCTTTTGCCATTCTGA
ReverseTGGAGAAACGACAGTGAAGTT
  • a The primers shown were used to amplify the KVAR_0717 gene of Klebsiella spp. in order to use this amplified sequence for genetic sequencing.