TABLE 1

Primer and probe sequences for the TaqMan array card assays

PathogenTargetSequence (5′–3′)aReference
Viruses
    ChikungunyaNSP4F: TCACTCCCTGYTGGACTTGATAGAModified (34)
R: TTGACGAACAGAGTTAGGAACATACC
P: AGGTACGCGCTTCAAGTTCGGCG
    CCHFNPF: CAAAGAAACACGTGCCGCTT
R: ATTCACCTCGATTTTGTTTTCCAT
P: ACGCCCACAGTGTTCTCTTGAGTGTTAGCA
    Dengue3′NCF: GGATAGACCAGAGATCCTGCTGT(35)
R: CATTCCATTTTCTGGCGTTC
R: CAATCCATCTTGCGGCGCTC
P: CAGCATCATTCCAGGCACAG
    Ebola ZaireNPF: TGGAAAAAACATTAAGAGAACACTTGC(28)
R: AGGAGAGAAACTGACCGGCAT
P: CATGCCGGAAGAGGAGACAACTGAAGC
    BundibugyoVP40F: MGCATCRTAYACCATCACTCA
R: SCCAGGACCAAGTCGRTTGA
P: TTTGGCAAAACCTCMAATCC
    SudanNPF: GCCATGGITTCAGGTTTGAG(13)
R: GGTIACATTGGGCAACAATTCA
P: ACGGTGCACATTCTCCTTTTCTCGGA
    HantavirusNPF: CATGGCWTCHAAGACWGTGGGModified (36)
R: TTKCCCCAGGCAACCAT
P: CAATCAATGGGRATACAACTGG
    Hepatitis EORF3F: GGTGGTTTCTGGGGTGAC(37)
R: AGGGGTTGGTTGGATGAA
P: TGATTCTCAGCCCTTCGC
    MarburgVP40F: GGACCACTGCTGGCCATATCModified (20)
R: GAGAACATITCGGCAGGAAG
P: AAAGTCCCAGAGAAGACA
    NipahNPF: CTGGTCTCTGCAGTTATCACCATCGA(38)
R: ACGTACTTAGCCCATCTTCTAGTTTCA
P: CAGCTCCCGACACTGCCGAGGAT
    ONNVE1F: GCAGGGAGGCCAGGACAGTModified (39)
R: GCCCCTTTTTCYTTGAGCCAGTA
P: TGTATTGCTCCTGCCGCTGG
    Rift Valley feverLF: TGAAAATTCCTGAGACACATGGModified (40)
R: ACTTCCTTGCATCATCTGATG
P: CACAAGTCCACACAGGCCCCTTACAT
    West Nile3′NCF: CAGACCACGCTACGGCG(41)
R: CTAGGGCCGCGTGGG
P: TCTGCGGAGAGTGCAGTCTGCGAT
    Yellow feverRdRpF: GGGAAAACTCAGGAGGAGGAModified (42)
F: GGGAGAATTCRGGGGGAGGA
R: AAGGTCTGCCTCTGTGATGC
P: TCAGAGACCTGGCTGCAATGGATGGT
Bacteria
    Bartonella spp.ssrAF: GGCTAAATIAGTAGTTGCAAAYGACAModified (43)
R: GCTTCTGTTGCCAGGTG
P: ACCCCGCTTAAACCTGCGACG
    Brucella spp.IS711F: GCTTGAAGCTTGCGGACAGT(44)
R: GGCCTACCGCTGCGAAT
P: AAGCCAACACCCGGCCATTATGGT
    Coxiella burnetiiIS1111F: CCGATCATTTGGGCGCT(45)
R: CGGCGGTGTTTAGGC
P: TTAACACGCCAAGAAACGTATCGCTGTG
    Leptospira spp.LipL32F: CCCTAIGGATCTGTRATCAACTAModified (46)
R: GAACTCCCATTTCAGCGATT
P: AAAGCCAGGACAAGCGCCG
    Rickettsia spp.23SF: AGCTTGCTTTTGGATCATTTGGModified (47)
R: TTCCTTGCCTTTTCATACATCTAGT
P: CCTGCTTCTATTTGTCTTGC
    Salmonella entericattrF: CTCACCAGGAGATTACAACATGG(48)
R: AGCTCAGACCAAAAGTGACCATC
P: CACCGACGGCGAGACCGACTTT
    Salmonella TyphiSTY0201F: CGCGAAGTCAGAGTCGACATAGModified (49)
R: AAGACCTCAACGCCGATCAC
P: CAGCCTGCTCCAGAACA
    Yersinia pestisCaf1F: CCACTGCAACGGCAACTCTT
R: TGTAATTGGAGCGCCTTCCT
P: TTGAACCAGCCCGCATCACTCTTACA
Protozoa
    Leishmania spp.18SF: AAGTGCTTTCCCATCGCAACTModified (50)
R: GACGCACTAAACCCCTCAA
P: CGGTTCGGTGTGTGGCGCC
    Plasmodium spp.18SF: GCTCTTTCTTGATTTCTTGGATGModified (51)
R: AGCAGGTTAAGATCTCGTTCG
P: CACGAACTAAAAACGGCCAT
    Trypanosoma brucei18SF: CGCCAAGCTAATACATGAACCAAModified (52)
R: TAATTTCATTCATTCGCTGGACG
P: CTTGTGTTTACGCACTTGTC
  • a F, forward primer; R, reverse primer; P, TaqMan MGB probe.