TABLE 1

RT-PCR assays for the detection of Zika virusa

Reference or sourceYrRT-PCR typeTargetPrimer/probe nameSequence 5′–3′Position
Lanciotti et al. (23)2008One step, real timeprMZIKV 835TTGGTCATGATACTGCTGATTGC835–857c
ZIKV 911cCCTTCCACAAAGTCCCTATTGC911–890
ZIKV 860-FAMbCGGCATACAGCATCAGGTGCATAGGAG860–886
Lanciotti et al. (23)2008One step, real timeEZIKV 1086CCGCTGCCCAACACAAG1086–1102c
ZIKV 1162cCCACTAACGTTCTTTTGCAGACAT1162–1139
ZIKV 1107-FAMbAGCCTACCTTGACAAGCAGTCAGACACTCAA1107–1137
PAHO2015One step, real timeZika 4481CTGTGGCATGAACCCAATAG4434–4453e
Zika 4552cATCCCATAGAGCACCACTCC4524–4505
Zika 4507c-FAMdCCACGCTCCAGCTGCAAAGG4479–4460
Faye et al. (71)2008One step, conventionalEZIKVENVFGCTGGDGCRGACACHGGRACT1538–1558c
ZIKVENVRRTCYACYGCCATYTGGRCTG1883–1902
Balm et al. (72)2012One step, conventionalNS5ZIKVF9027CCTTGGATTCTTGAACGAGGA9121–9141c
ZIKVR9197cAGAGCTTCATTCTCCAGATCAA9312–9290
Faye et al. (73)2013One step, real timeNS5Forward primerAARTACACATACCARAACAAAGTGGT9365–9390c
Reverse primerTCCRCTCCCYCTYTGGTCTTG9466–9446
ProbefCTYAGACCAGCTGAAR9398–9413
Tappe et al. (66)2014One step, real timeNS3ZIKAfTGGAGATGAGTACATGTATG6001–6020c
ZIKArGGTAGATGTTGTCAAGAAG6095–6077
ZIKApgCTGATGAAGGCCATGCACACTG6039–6060
Pyke et al. (74)2014One step, real timeEZika E ForAAGTTTGCATGCTCCAAGAAAAT1222–1244e
Zika E RevCAGCATTATCCGGTACTCCAGAT1293–1271
Zika E probehACCGGGAAGAGCATCCAGCCAGA1246–1268
Pyke et al. (74)2014One step, real timeNS1Zika NS1 ForGCACAATGCCCCCACTGT3329–3346e
Zika NS1 RevTGGGCCTTATCTCCATTCCA3394–3375
Zika NS1 probehTTCCGGGCTAAAGATGGCTGTTGGT3349–3373
  • a RT-PCR, reverse transcriptase PCR; PAHO, Pan American Health Organization; prM, precursor membrane; E, envelope; NS5, nonstructural protein 5; NS3, nonstructural protein 3; NS1, nonstructural protein 1; For, forward; Rev, reverse.

  • b The probe was labeled with 5-carboxyfluorescein (5-FAM) at the 5′ end. The 3′ quencher was not specified.

  • c Numbering according to Zika virus strain MR-766 (GenBank accession number AY632535).

  • d The probe was labeled with fluorescein; the isomer was not specified. The quencher was not specified.

  • e Numbering according to Zika virus strain Yap 2007 (GenBank accession number EU545988).

  • f The probe was labeled with 6-carboxyfluorescein (6-FAM) at the 5′ end. The 3′ quencher is listed as 5-carboxytetramethylrhodamine (TAMRA) in the article text and black berry quencher (BBQ) in the article table. The probe is listed as containing locked nucleic acids (LNA). The residues utilizing LNA chemistry were not specified.

  • g The probe was labeled with 6-carboxyfluorescein (6-FAM) at the 5′ end. The 3′ quencher was black hole quencher-1 (BHQ-1).

  • h The probe was labeled with fluorescein; the isomer was not specified. TAMRA was used as quencher.