TABLE 2.

Alignment of the selected 16S rRNA gene regions of type strains and clinical isolates of F. nucleatum and F. periodonticum

Species or clusterNucleotide at positiona:
69707172737475767778798081828384858687888990
Escherichia coliGTAACAGGAAGAAGCTTGCTTC
C2GAATTTGGGTTTTTTAAC
C3GAATTTGGGTTTTTAAC
C4GAATTTGGGTTTTTAAC
C1GAAC
C5GAAC
C6GAAC
  • a Corresponding to positions in the E. coli 16S rRNA gene (GenBank accession no. 3DG5_A).