TABLE 1.

Nucleotide sequences of the oligonucleotide primers used in the studya

LocusPrimer namebPrimer sequence (5′-3′)Amplicon size (bp)Locus size (bp)cReference or source
adkadk1FTTACTTGGACCTCCAGGTGC635501This study
adk1RTTTCCACTTCCTAAGGCTGC
atpAatpA1FTGATGATTTAAGTAAACAAGCTG674555This study
atpA1RAATCATGAGTGAAGTCTTCTCC
dxrdxr3FGCTACTTTCCATTCTATCTG525411This study
dxr4RCCAACTCTTTGTGCTATAAA
glyAglyA1FATAGCTGATGAGGTTGGAGC625516This study
glyA1RTTCTAGCCTTAGATTCTTCATC
recArecA2FCAGTAATGAAATTGGGAGAAGC705564This study
recA2RATTCAGCTTGCTTAAATGGTG
sodAsodA5FCCAGTTGTCAATGTATTCATTTC585450This study
sodA6RATAACTTCATTTGCTTTTACACC
tpitpi2FATGAGAAAACCTATAATTGCAG640504This study
tpi2RTTGAAGGTTTAACACTTCCACC
tcdAtcdA-FAGATTCCTATATTTACATGACAATAT369 (A+ B+)dNA21
tcdA-RGTATCAGGCATAAAGTAATATACTTT110 (A B+)d
tcdBtcdB1TGATGAAGATACAGCAGAAGC688NAThis study
tcdB2TGATTCTCCCTCAAAATTCTC
tcdCtcdC-F(−17)AAAAGGGAGATTGTATTATGTTTTC479NA33
tcdC-R(+462)CAATAACTTGAATAACCTTACCTTCA
cdd1lok1(cdd1)AAAATATACTGCACATCTGTATAC769NA3
cdu1lok3 (cdu1)TTTACCAGAAAAAGTAGCTTTAA
  • a Primers were used (i) to perform C. difficile MLST, (ii) to detect the presence of three loci within the pathogenicity locus (tcdA, tcdB, and tcdC), and (iii) to confirm the absence of the pathogenicity locus in nontoxigenic strains (lok1/lok3).

  • b In the primer names F indicates forward, and R indicates reverse.

  • c NA, not applicable.

  • d The size of the amplicon varies with the strain genotype.