TABLE 1.

Probes included on the chip

Target bacteriaProbe nameProbe sequence (5′ to 3′)Accession no. (GenBank) or source
All bacteriaUni_459CCGATAGTGAACCAGTACC
Gram-positive bacteria
     NonspecificGP_01YTTVTTYAGTTTTGAGAGGTY
GP_02TGTATTCAGTTTTGAATGTTY
    Enterococcus spp.EncGAGTTTTTTAATAAGTTCAATTG
        E. faecalisEnc_fsGCTTATTTATTGATTAACC AY351321
        E. faeciumEnc_fmAGACTACACAATTTGTTTTT AY351317
        E. aviumEnc_avGGATACAGAAACAATTTTAA AY116901
    Listeria spp.LisCACAAGTAACCGAGAATCATCTG
        L. monocytogenesLis_moCATAGATAATTTATTATTTATGAC AF514302
        L. ivanoviiLis_ivCTGTATAACCTATTTAAGGG U57913
        L. grayiLis_grGAAACTTTCCGCTTTGGAAG U57918
        L. welshimeriLis_weAGAAAACAAAATATTATTTCC U57917
    Staphylococcus spp.StaAGATTTTACCAAGCAAAACCG
        S. aureusSta_auAAACGCGTTATTAATCTTGTGA U11787
        S. epidermidisSta_epTTGAATTCVTAAATAATCGC U90018
        S. saprophyticusSta_saCTTACGAAGATGCAGGAAT EU430992
    Streptococcus spp.StrCATTGAAAATTGAATAWCKA
        S. agalactiaeStr_agAGGAAACCTGCCATTTGCGTC AF489592
        S. pneumoniaeStr_pnATCACCAAGTAATGCACATTG AY347556
        S. pyogenesStr_pyACACGTTTATCGTCTTATTTAG AY347560
        S. bovisStr_boGTTTAAGGTCAACAGAACCAA AY347547
Gram-negative bacteria
    NonspecificGN_01CTCAGTTGGTTAGAGCGCSMCM
    Bacteroides spp.BacGTAGAGGTCGGCAGTTCAAC
        B. fragilisBac_frGAAAAGGAGATGAATCTGGC AF172709
        B. thetaiotaomicronBac_thGGTTAATACCTGATACTT AF172710
        B. ovatusBac_ovCCAGTATGAGAATAAAACGTT AF176691
    Escherichia coliEsc_coAAAAAAGAAGCGTWCTTTGMAGTGCTC AY684796
    Enterobacter/Klebsiella spp.Kle/EnbTAATGTGTGTTCGAGTCTCT
        E. cloacaeEnb_clCGAAGGGGACGTACAGTCTCA AY116915
        E. aerogenesEnb_aeAAGTAGAGAAGCAAGGGGTC AF047426
        E. agglomeransEnb_agGATACCTTCCCGCGCAGTGTCC AF041584
        K. pneumoniaeKle_pnGACGCGTGCCGATGTATC AF047425
        K. oxytocaKle_oxGCTGCGAAGTCGCGACACCT AY116899
    Haemophilus spp.HaeCGAATCCCCGTGGGGACGCCA
        H. influenzaeHae_inGAGAGAAAGTCTGAGTAGGCAOur laboratory
        H. ducreyiHae_duAAGTAGAAAGTCTGAGTAATCOur laboratory
    Pseudomonas spp.PseACAGTATAACCAGATTGCTT
        P. aeruginosaPse_aeCCATCTAAAACAATCGTCG AY684792
        P. stutzeriPse_stCACGTTATAGACAGTAACC AJ635307
    Serratia spp.SerCCTCCTTACCTAASGATATT
        S. marcescensSer_maGCCACTCGAACTAATATCTTOur laboratory
        S. grimesiiSer_grGATATTGATTGCGTGAAGTGCOur laboratory
        S. entomophilaSer_enCACTTCACTCGAATCAATATCOur laboratory