TABLE 1.

DNA sequence of FISH probes

In situ probe5′-end modification/colorDNA sequence (5′ → 3′)
UniversalFLO/green, Alexa 594/redCGTATTACCGCGGCTGCTGGCAC
EUB 338Alexa 488/green, Alexa 594/redGCTGCCTCCCGTAGGAGT
Lactobacillaceae Alexa 488/greenGTCCATTGTGGAAGATTCCC
Bacteroides Alexa 594/redATACGCGTTACKCACCCGTG
Streptococcaceae Alexa 594/redTAGCCGTCCCTTTCTGGT
Veillonellaceae Alexa 532/orangeTCATCCTCTCAGACCGGCTAC
Stenotrophomonas Alexa 488/greenGCTGGATTTCTTTCCCAACAA
Acinetobacter Alexa 488/greenTCCTCCTCGCTTAAAGTGCTT
Coriobacteriaceae Alexa 488/green, Marina Blue/blueCCGGTCGGTCTCTCAACC
Pseudoramibacter alactolyticus Alexa 488/greenACTCCCGATTTCTCGAGGC
Propionibacterium Alexa 488/greenACTCGCGCTTCGTCATG
Fusobacterium Alexa 488/greenCTAATGGGACGCAAAGCTCTC
Lachnospiraceae Alexa 594/red, Alexa 488/greenTTCCCTGCTGATAGAGCTTTACATAC
Gammaproteobacteria Alexa 488/greenGCCTTCCCACATCGTTT