TABLE 2.

Primers and probes for Ureaplasma species-specific and serovar-specific PCR assays

Species or serovarTargetPrimer or probeSequence (5′-3′)Amplicon size (bp)
U. parvumUP063UP063#1FTGCGGTGTTTGTGAACT152
UP063#1RTGATCAAACTGATATCGCAATTATAGA
UP063#1 probe 1TGGTTTAACGTGTTTTTGAAGTGCTACAAAAT-FLc
UP063#1 probe 2LC Red 640-CCCATTTCAGCCATGGTGCCATCA
U. urealyticumUUR10_0680UU127#1FGGATTTGTTAGATATCGTCAAGG
UU127#1RTCATCTTTTAAAGCTCCACATTATTAGT152
UU127#1 probe 1AACACGAGTATGGATGAAATCAAAATCATCAAA-FL
UU127#1 probe 2LC Red 705-AATAACGGTGGTTCAGCTATTTGAGTATGAGC
Serovar 1MBAa (UPA1_G0002,gcontig_1106501367851)dUP1F1-2GATAATTTGAATTATCAAACAGAAAAAGTG116
UP1R1-2TGTTCTTTACCTGGTTGTTGT
UP1 probe 1FL-SPCe-GAACCAAAAGAAAATGGTGGAGAACAACC
Serovar 2Putative lipoprotein (UUR2_0261, gcontig_1118448734166)UU2_F_1GCTTGTTGATAAGCAAAAGGATTAC76
UU2_R_1GTTTTGGTTCTGGATTGTTTGAC
Serovar 3CHPb (UPA3_0391/UU376, NC_010503)UP3F1-2AATAATGCAAATTATGATGTTAAATTAACC63
UP3R1-2TGTTTCTATGTTAACATTTAACAATTTAGC
Serovar 4Intergenic (gcontig_1105428130534)Uu04_1FCTAAAGCGTGCTTAATGTGT162
Uu04_1RGTTAGTTTGGGAACCACCT
Uu04_1 probe 1TGTTATTATTATAGAAATTGTTGTAAGAATCAAAG-FL
Uu04_1 probe 2LC Red 610-ATAATTTCGTATAATGTCATGTTGTTCACCTCCTT
Serovar 5ATP-dependent RNA helicase (UUR5_G0006, gcontig_1105469453572)Uu05-3FATTATGAAAAATTAAACTCTCATTACTCG121
Uu05-3RTTCTCATATTGAAAAGAAAATGAATGCTC
Uu05-3 probeFL-SPC-AGGAAGAATAAAACATTTTAATTTATATCCACGAA
Serovar 6MBA (UPA6_A0411, gcontig_1105428157138)UP6F1GAACTTTGAAACAGCTCCG60
UP6R1CCTGGTTCTTTACCTGGTTCTTTA
Serovar 7MBA (UUR7_0421, gcontig_1104407586372)UU7_F_1CAAACAAAGCATTAACAGCTTCAAAA58
UU7_R_1TTATTAACTTCTTCCTTTGTTGTAAGTGTAGC
Serovar 8Intergenic (gcontig_1118436613429)UU8_F_1AGTTTTAATTATTTCGTTGTTTAAGTAGC60
UU8_R_1AGTTTTTACGTGGTAAGTGGTT
Serovar 9FtsK/spoIIIE family protein (UUR9_0160, gcontig_1105462525206)UU9_F_1CGAAGCGGAAGTCGCAGGT51
UU9_R_1TATTGCCACACCAGCCAGCA
Serovar 10MBA (UUR10_0418, NC_011374)UU10_F_4TGCATCAACATCGCTAAATTCA95
UU10_R_4ATACGCCTACTCCGACT
UU10_P_4FL-SPC-TTGGTGTAGGTGTTGGTTGTGG
Serovar 11Intergenic (gcontig_1105428123667)UU11_F_1AACCTTATCAATTCTATTAATCATAGTTCA126
UU11_R_1TGAAAACAAAAAACACGCTCC
UU11_P_1FL-SPC-AAACCAAACTAACACATTAAGCACGC
Serovar 12CHP (UUR12_A0390, gcontig_1105428175482)Uu12_1FAATTGGTCAAACAACATATCGTG167
Uu12_1RATTTAACACGATTAACATCTTCACGTTTA
Uu12_1 probe 1TTTGCGAAGCATTACCGCCAAATAC-FL
Uu12 _1 probe 2LC Red 705-GGCTTAGTTATGAACCAGCTGTTATTAATATAGCG
Serovar 13F_1: CHP; R_1: putative SSB protein (gcontig_1106518107722)13_F_1CCAAGACCAGCACCTACTGCC90
13_R_1AGAAAACGAGGAGGAATAAATAATGGATT
Serovar 14Intergenic (gcontig_1106438328052)UP14F1TCCACACTACGGTAAGTAGTTT60
UP14R1CGCGCAGACCCTTGAATA
  • a MBA, multiple-banded antigen.

  • b CHP, conserved hypothetical protein.

  • c FL, fluorescein.

  • d Target names in parentheses are National Center for Biotechnology Information names.

  • e SPC, Simple Probe Chemistry.