TABLE 1.

DNA probes used for the detection of mycobacteria

NameSequence (5′-3′)aTargetConjugationUse
MYCO4AAAAAATTAGTACCGTGAGGGAATGGTGAAAAGTA Mycobacterium spp. 23S rRNA geneMBsCapture
TB1AAAAAGGTTTGCGGTGGGGTGTCGAGTCGATCTGC M. tuberculosis complex IS6110 transposaseQDsDetection
MAP3AAAAAGCAACAACCACCTCCGTAACCGTCATTGTC M. avium subsp. paratuberculosis insertion sequence IS900 QDsDetection
  • a 5′ biotinylated.