TABLE 4.

Nucleotide sequences and lengths of spacers between groES and groEL among species

StrainSpacer length (bp)Spacer sequence (5′-3′)
A. defectiva ATCC 4917635GCACAAGGCAGAGAATAGAAAAGGAGTGACTCTTG
Gr. adiacens ATCC 4917514AGGAGGATATCACA
Gr. elegans ATCC 70063319GAAAGCGAGGAAATGAAAA
Ge. haemolysans ATCC 103798GAGGAAAC
Ge. haemolysans NTUH_146550TTTTATTACTATTTGGAACAAACAAATAATAAAGAGATTTAGGAGGAAAC
Ge. haemolysans NTUH_219645GTTCGTATCTAAAAAAAGAGATGTTTTAGTATTATAGGAGGAATC
Ge. morbillorum ATCC 278248GAGGATAT
Ge. sanguinis ATCC 7006328GAGGAAAT