TABLE 1.

Primers used in this study

PrimerSequence (5′ to 3′)aGeneNucleotide positions
Universal amplification primers
    Gor600FGGNGAYGGNACNACNACNGCNACNGTgroEL253-278
    Gor600RTCNCCRAANCCNGGYGCNTTNACNGCgroEL842-817
LA PCR amplification primers
    C1GTACATATTGTCGTTAGAACGCGTAATACGACTCA
    C2CGTTAGAACGCGTAATACGACTCACTATAGGGAGA
    LA-Gm-F1GTTGAACGTCTTCGTGAAATTAGCGTAACgroEL377-405
    LA-Gm-F2AAGTAGGTGCTATTTCTGCTGCGGATGAAgroEL432-460
    LA-Gm-R1GTCGCTATAGCTTCTTGTTCGACATCATCgroEL774-746
    LA-Gm-R2GCAGCAGCAACTACTTCTTCTAAAACTGGgroEL723-695
Primers for PCR amplification of Gemella species
    Gm-400FCTTCATATCCGAAGTGCGATGTTgroES−398-−420
    ORF179-199RCTCCGTATTCTCCAGCTGCTTtrxA199-179
Primers for PCR amplification of NVS
    Ent-ES-UPTTATAAAYAGTGTRRGTTAGCACTC
    EL587-563RTADCCNCGRTCAAATTGCATHCCTTgroEL587-563
    ES5-29FTAAAACCHTTAGGHGAHCGWRTBGTgroES5-29
    EL1240RCCACCACCWGVWACNAWDCCTTCgroEL1241-1219
Primers for multiplex PCR
    Abio EL220FGTGCTAGAAGTGGCTAGgroEL217-233
    Gra ES200FCACTGAAGTTAAATTGGATGGTCgroES198-220
    Gem EL30FCAGAAGATGCTCGCCAATgroEL23-40
    NG EL570RCGRTCAAATTGCATHCCTTCgroEL584-565
  • a Y = T or C, H = A, T, or C, R = A or G, N = A, T, G, or C, W = A or T, B = T, G, or C, V = A, G, or C, and D = A, T, or G.