TABLE 2.

C. diphtheriae housekeeping genes, gene functions, and amplification and sequencing primers used in the MLST schemea

GeneGene functionAmplification primer, 5′-3′Amplicon size (bp)Sequencing primer, 5′-3′Allele size (bp)
FwdRevFwdRev
atpAATP synthase alpha chainGCGATTGCGAACTACACCCTCGAGGAATACCTRACC1,029AGAAGGCGACGAAGTMAAGCCRGAATCAGAAGCTGGWGCA378
dnaEDNA polymerase III alpha subunitTGCGTCATCTGATTGAAACGGTCCAATAAGACACCA858GTGCGACAAGCTGGTGTGGGCTTWCGGCCATTYTTG354
dnaKChaperone protein DnaKACTTGGGTGGCGGTACTTTGGTGAACGTCTCGGAAC696AGATGGCTATGCAGCGTCTGATGAGCTTGGTCATCACG345
fusAElongation factor GTACCGCGAGAAGCTCGTTGAAGGTTGGGTCCTCTTC683CGTAAGCTGACCGTTAACTCCCATGGACTCRAGGATGA360
leuA2-Isopropylmalate synthaseCGTGCACTTCTACAACTCACCGTGATCGGTCTTCAT865CCYATCATCATCAAYCTGCCCAGCTGGTTGCAGTAYTC384
odha2-Oxoglutarate dehydrogenaseCGGCAAGGAAASCATGACGTTGTCGCCRAACATCTG505TBCAAGATCGCATYGARRCTWGGCTCGATGTGKCCTTC382
rpoBRNA polymerase beta chainAAGCGCAAGATCCAGGACTCGAACTCGTCGTCATCC845CGWATGAACATYGGBCAGGTTCCATYTCRCCRAARCGCTG342
  • a Fwd, forward; Rev, reverse.