TABLE 1.

Primers used in this study

PCRReactionGene namePrimerPrimer sequenceProduct size (bp)ReferenceProduct (Tm [°C])a
Preliminary1 narGHJI LC665′AACCGACGGTGTGGTTGAC′3155Stermann et al. (13)
LC675′ATCTCGATGGATGGGCGTC′3
2 oxyR LC905′CGGGTGCCGCTGACCGCG′3200Stermann et al. (13)
LC915′CCAGCCGGCTTCGCGTGG′3
Real-time1 narGHJI narF5′CGCCGTCAACTTGGTTAGA′3 M. tuberculosis (84.26 ± 0.09)
narR5′GTCCTGCCCGGAAGTTGT′3108 M. bovis (85.04 ± 0.02)
2 oxyR oxyF5′ACACTGATTCCGCAGACC′3 M. bovis (91.9 ± 0.03)
oxyR5′AAAGTCAGCTCTGACAGCGC′3151 M. bovis (91.27 ± 0.04)
  • a The product melting temperatures (Tm ) are given as means ± standard errors.