TABLE 3.

Oligonucleotide sequences used in the HPV E7 type-specific PCR

PrimerSequence (5′-3′)ProbeSequence (5′-3′)
HPV16E7.667BioGATGAAATAGATGGTCCAGC16E7DIGPROCGGACAGAGCCCATTACAATATTGTAACCT
HPV16E7.774BioGCTTTGTACGCACAACCGAAGC
HPV18E7.696AAGAAAACGATGAAATAGATGGA18E7DIGPROCCCGACGAGCCGAACCACAACGTCACACAA
HPV18E7.799BioGGCTTCACACTTACAACACA
HPV31E7.811GGGCTCATTTGGAATCGTGTG31E7DIGPROTACCTGCTGGATCAGCCATTGTAGTTACAG
HPV31E7.890BioAACCATTGCATCCCGTCCCC
HPV33E7.671BioTGAGGATGAAGGCTTGGACC33E7DIGPROTGTGACAACAGGTTACAATGTAGTAATCAG
HPV33E7.761TGACACATAAACGAACTGTG
HPV35E7.674BioCTATTGACGGTCCAGCT35E7DIGPROCAACAGGACGTTACAATATTATAATTGGAG
HPV35E7.752TACACACAGACGTAGTGTCG
HPV39E7.601BioCCAAAGCCCACCTTGCAGGA39E7DIGPROTCCTAATTGCTCGTGACATACAAGGTCAAC
HPV39E7.703ATGGTCGGGTTCATCTATTTC
HPV45E7.741BioCCCACGAGCCGAACCACAG45E7DIGPROAGCTCAATTCTGCCGTCACACTTACAACAT
HPV45E7.822TCTAAGGTCCTCTGCCGAGC
HPV51E7.718TACGTGTTACAGAATTGAAG51E7DIGPROTCAAGTGTAGTACAACTGGCAGTGGAAAGC
HPV51E7.841BioAACCAGGCTTAGTTCGCCCATT
HPV52E7.691BioGCAGAACAAGCCACAAGCAA52E7DIGPROATAGCCGTAGTGTGCTATCACAACTGTGAC
HPV52E7.776TAGAGTACGAAGGTCCGTCG
HPV56E7.784GGTGCAGTTGGACATTCAGAG56E7DIGPROCAAAGAGGACCTGCGTGTTGTACAACAGCT
HPV56E7.886BioGTTACTTGATGCGCAGAGTG
HPV58E7.98CGAGGATGAAATAGGCTTGG58E7DIGPROACAGCTAATTACTACATTGTAACTTGTTGT
HPV58E7.761BioACACAAACGAACCGTGGTGC
HPV59E7.646CTCCGAGAATGAAAAAGATGAA59E7DIGPROATCATCCTTTGCTACTAGCTAGACGAGCTG
HPV59E7.749BioGCTGAAGTTGATTATTACA
HPV66E7.641AATGCAATGAGCAATTGGACAG66E7DIGPROAGGATGAAATAGACCATTTGCTGGAGCGGC
HPV66E7.742BioCTTATGTTGTTCAGCTTGTC
HPV68E7.4604AACAACAGCGTCACACAATTCA68E7DIGPROAGTGTAACAACCTACTGCAACTAGTAGTAG
HPV68E7.4704BioAGTTGTACGTTCCGCAGGTT