TABLE 2.

PCR and sequencing primers used in this study

GeneORF size (bp)Deoxynucleotide primeraAmplicon size (bp)
Function(s)TypeSequence (5′→3′)Locationb
ace 2,025cPCR, sequencingForwardGAGCAAAAGTTCAATCGTTGAC99-1201,003
PCR, sequencingReversedGTCTGTCTTTTCACTTGTTTCT1101-1080
SequencingForwardCCAAATTGAGCGAGACTATC510-529
SequencingForwardCACTTGCCGAGTTTGAGC719-736
SequencingReverseGAGAACTATTGGTGATAAGCG424-404
efaA 924PCR, sequencingForwardCGTTAGCTGCTTGCGGGAATC47-67
PCR, sequencingReverseCCATACTACGTTTATCGACAC781-761735
SequencingForwardCCACAATATTTAACAAGTGCC364-384
SequencingForwardCAAACTACATGAGGAAGCC537-555
SequencingReverseGTTTGTTCTTGACCGGCAC398-380
pyrC 1,284PCR, sequencingForwardCGGGTAGTAAAGCTGCTGC227-245361
PCR, sequencingReverseCTTCTCCTTCATGCATCACAC586-566
salA 1,449PCR, sequencingForwardCATTAACAAGCGTAGCGTTG44-63922
PCR, sequencingReverseGCCTTTTTCAGGAGTCGTTG1005-986
SequencingForwardGATGCTGTCTTAGATGCAG364-382
SequencingForwardGCACAACGTTCTGAAGAACAAG613-634
SequencingReverseCACTTGGACATCGCGTGC339-322
  • a ace, efaA, pyrC, and salA primers were designed from E. faecalis strain V583 database sequences (The Institute for Genomic Research).

  • b Numbering for all the primers is given relative to the start codon (ATG for ace, efaA, and pyrC; TTG for salA) for the respective genes.

  • c ace ORF size represented here is for E. faecalis strain V583 (36). ace gene size varies in different E. faecalis strains due to variation in the number of repeats of the B domain (31).

  • d See text for the reverse primer used for the selected strains.