TABLE 2

HRV genotype sequence groups and RT-PCR genotype-specific primer and probe sequences

Sequence group (No. of genotypes)HRV genotypesaGenotype-specific sequences (forward primer/reverse primer/probe)b
A (27)3, 4, 6, 13, 14, 17–19, 27, 37, 41, 48, 49, 53, 61, 73, 79, 82–84, 90, 92, 93, 96, 97, C12, C13CTAGCCTGCGTGGC/GAAACACGGACACCCAAAGTA/TCCTCCGGCCCCTGAATGYGGC
B (41)2, 8–11, 15, 16, 20, 21, 23–25, 29, 30, 32, 34, 38, 40, 44, 46, 50, 54–57, 60, 62, 66–68, 74, 76, 80, 81, 85, 95, 98, 100, C3, C6, C22
C (12)1A, 1B, 22, 43, 51, 64, 71, 75, 86, 94, C16, C17CCAGCCTGCGTGGC/GAAACACGGACACCCAAAGTA/TCCTCCGGCCCCTGAATGYGGC
D (13)7, 12, 31, 36, 39, 45, 47, 58, 89, C4, C10, C39, C49
E (8)5, 35, 42, 52, 65, 69, 91, C43TCAGCCTGCGTGGC/GAAACACGGACACCCAAAGTA/TCCTCCGGCCCCTGAATGYGGC
F (2)26, 99TTAGCCTGCGTGGC/GAAACACGGACACCCAAAGTA/TCCTCCGGCCCCTGAATGYGGC
H (1)28
G (2)59, 63CTAGCCTGCGTGGC/GAAACACGGACATCCAAAGTA/TCCTCCGGCTCCTGAATGTGGC
I (1)33CTAGCCTGCGCGGC/GAAACACGGACACCCAAAGTA/TCCTCCGGCCCCTGAATGYGGC
J (1)70TCAGCCTGCGTGGC/GAAACACGGACACCCAAAGTA/TCCTCCGGCCCCCGAATGCGGC
K (1)72CCAGCCTGCGTGGC/GAAACACGGACACCCAAAGTA/TCCGCCGGCCCCTGAATGCGGC
L (4)77, C15, C23, C30CTTGCCTGCGTGGC/TACTTTGGGTGTCCGTGTTTC/TCCTCCGGCCCCTGAATGYGGC
M (5)78, C7, C21, C31, C42CTAGCCCGCGTGGC/GAAACACGGACACCCAAAGTA/TCCTCCGGCCCCTGAATGYGGC
N (1)88CCAGCTTGCGTGGC/GAAACACGGACACCCAAAGTA/TCCTCCGGCCCCTGAATGYGGC
O (6)C2, C5, C11, C24, C25, C27NDc
P (3)C8, C18, C28ND
Q (2)C29, C45ND
R (3)C19, C26, C55GTAGCCTGCGTGGT/GAAACACGGACACCCAAAGTA/TCCTCCGGCCCCTGAATGYGGC
S (1)C20ND
T (2)C37, C51ND
U (6)C9, C14, C33, C36, C38, C46GTAGCCCGCGTGGT/GAAACACGGACACCCAAAGTA/TCCTCCGGCCCCTGAATGYGGC
V (1)C35ND
  • a The representative HRV genotype used to generate the RNA transcript for each group is in bold.

  • b Probes were 5′-labeled with 6-carboxyfluorescein (6FAM) and 3′-labeled with black hole quencher 1 (BHQ1).

  • c ND, not tested.