Table 1.

PCR primers for amplification of vacA andcagA sequences

Gene and primer (polarity)Sequence (5′-3′)aPosition
vacA s region
   VA1F (+)b ATGGAAATACAACAAACACAC1–21c , d
 VA1R (−)b CTGCTTGAATGCGCCAAAC241–259cand 268–286d
 VA1XR (−)CCTGARACCGTTCCTACAGC157–176c and 184–203d
vacA m region
   HPMGF (+)CACAGCCACTTTCAATAACGA1443–1463c and 1419–1439d
 HPMGR (−)CGTCAAAATAATTCCAAGGG1824–1843c and 1875–1894d
 MF1 (+)GTGGATGCYCATACRGCTWA1495–1514c and 1471–1490d
 MR1 (−)RTGAGCTTGTTGATATTGAC1582–1601c and 1633–1652d
cagA
   cagAF (+)TTGACCAACAACCACAAACCGAAG17–40e
 cagAR (−)CTTCCCTTAATTGCGAGATTCC178–199e
  • a R is A or G, W is A or T, and Y is = C or T.

  • b VA1F and VA1R have been published earlier by Atherton et al. (3).

  • c Nucleotide position numbers are according to the start codon of the vacA open reading frame in strain 60190 (GenBank accession no. U05676 ) for s1 and m1.

  • d Nucleotide position numbers are according to the start codon of the vacA open reading frame in strain Tx30a (GenBank accession no. U29401 ) for s2 and m2.

  • e For detection of cagA the positions are according to the start codon of the cagA open reading frame in the sequence of the strain with GenBank accession no.L11714 .