Table 1.

Primers used in the study

Gene and DNA region amplifiedPrimerNucleotide sequenceProduct size (bp)aSource or reference
vacA 2
 s1VA1-FATGGAAATACAACAAACACAC
VA1-RCTGCTTGAATGCGCCAAAC259
 s2VA1-FATGGAAATACAACAAACACAC
VA1-RCTGCTTGAATGCGCCAAAC286
 s1aSS1-Fb GTCAGCATCACACCGCAAC190
 s1bSS3-Fb AGCGCCATACCGCAAGAG187
 s2SS2-Fb GCTAACACGCCAAATGATCC199
 m1VA3-FGGTCAAAATGCGGTCATGG
VA3-RCCATTGGTACCTGTAGAAAC290
 m2VA4-FGGAGCCCCAGGAAACATTG
VA4-RCATAACTAGCGCCTTGCAC352
vacA This study
 mx (m1a)VA3.1-Rc CTGTTAGTGCCCGCAGAAAC290
 mx (m1a)VA3.2-Rc CTAATGCTGTTAGTGCCCGC290
 MidregionVA6-FTCAATATCAACAAGCTC
VA5-RCCGCATGCTTTAATGTC785
cagA 5
 MidregionCAG-Ld TGCTAAATTAGACAACTTGAGCGA
CAG-Rd AATAATCAACAAACATCACGCCAT289
  • a Size of PCR products is given for individual strains and can vary among strains.

  • b Used in combination with primer VA1-R.

  • c Used in combination with primer VA3-F; the oligonucleotide sequence is located at positions 2821 to 2840 of thevacA DNA sequence, EMBL database accession no. Z26883 (15).

  • d Primers for detection of cagA were kindly provided by Antonello Covacci.